|
| Status |
Public on Jul 01, 2024 |
| Title |
kin-3_piRNA_2 |
| Sample type |
SRA |
| |
|
| Source name |
whole worm
|
| Organism |
Caenorhabditis elegans |
| Characteristics |
tissue: whole worm
genotype: kin-3
treatment: cultured with 500uM IAA
|
| Extracted molecule |
other |
| Extraction protocol |
The small RNA cloning was conducted. Total RNAs were extracted by Trizol (Sigma Alrich) and small RNAs were enriched by an mir-Vana miRNA isolation kit (Thermo Scientific).
Samples were pretreated with homemade PIR-1 . The small RNAs were then ligated to a 3’ adaptor (5’ rAppAGATCGGAAGAGCACACGTCTGAACTCCAGTCA/3ddC/3’; IDT) by T4 RNA ligase 2(NEB). The 5’ adaptor containing 6 nt barcode was ligated using T4 RNA ligase 1. The ligated products were reverse transcribed using SuperScript III (Thermo Fisher Scientific). The cDNAs were amplified by PCR and the libraries were sequenced using the HiSeq systems (Illumina) platform at the UMass Medical School Deep Sequencing Core Facility.
|
| |
|
| Library strategy |
ncRNA-Seq |
| Library source |
other |
| Library selection |
size fractionation |
| Instrument model |
Illumina NextSeq 500 |
| |
|
| Data processing |
Adaptors were trimmed from fastq files using cutadapt v1.18.
Reads were trimmed to retain only 18-30 nts using cutadapt v1.18.
The reads were mapped to piRNAs with an arbitrary length of overhanging sequence either side of the 21U sequence using the exact matches using bowtie v1.2.1.1.
Reads were normalized to the total reads using excel.
Assembly: piRNAdb.cel.v1_7_6.fa
Supplementary files format and content: txt
|
| |
|
| Submission date |
Jul 26, 2023 |
| Last update date |
Jul 01, 2024 |
| Contact name |
Chunwei Zheng |
| E-mail(s) |
chunwei.zheng@umassmed.edu
|
| Phone |
8572695045
|
| Organization name |
UMass medical school
|
| Street address |
70 Shrewsbury Green Dr, Unit L, Unit L
|
| City |
Shrewsbury |
| State/province |
MA |
| ZIP/Postal code |
01545-3685 |
| Country |
USA |
| |
|
| Platform ID |
GPL19757 |
| Series (1) |
| GSE239315 |
Casein kinase II promotes piRNA production through direct phosphorylation of USTC component TOFU-4 |
|
| Relations |
| BioSample |
SAMN36717436 |
| SRA |
SRX21165456 |
