|
| Status |
Public on Sep 08, 2023 |
| Title |
K562_H3K4me3_40k_whole-cell_(230421_SH_Hs_K4m3_Kl_0405) |
| Sample type |
SRA |
| |
|
| Source name |
CUT&Tag-direct_v4
|
| Organism |
Homo sapiens |
| Characteristics |
antibody: H3K4me3 Active Motif 39159
cell type: K562 human immortalised myelogenous leukemia cell line
|
| Extracted molecule |
genomic DNA |
| Extraction protocol |
https://www.protocols.io/view/cut-amp-tag-direct-for-whole-cells-with-cutac-x54v9mkmzg3e/v4
CUT&Tag uses tagmentation in which the barcoded adapters are integrated on both sides of the insert, so that the DNA that is released is already a barcoded library. PMID:31036827
|
| |
|
| Library strategy |
OTHER |
| Library source |
genomic |
| Library selection |
other |
| Instrument model |
NextSeq 2000 |
| |
|
| Description |
H3K4me3 CUT&Tag-direct_v4 40k K562 cells
|
| Data processing |
Genome_build: hg19
1. We used cutadapt 2.9 with parameters "-j 8 --nextseq-trim 20 -m 20 -a AGATCGGAAGAGCACACGTCTGAACTCCAGTCA -A AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT -Z" to trim adapters from 50bp paired-end reads. 2. We used Bowtie2 2.4.4 with options "--very-sensitive-local --soft-clipped-unmapped-tlen --dovetail --no-mixed --no-discordant -q --phred33 -I 10 -X 1000" to map the paired-end 50bp reads to the repeat-masked hg19 Homo sapiens reference sequence obtained from UCSC. 3. We used samtools 1.14 "view" to extract properly paired reads from the hg19 alignments. 4. We used bedtools 2.30.0 "genomecov" to make a normalized count hg19 track which is the fraction of counts at each base pair scaled by the size of the hg19 reference sequence (3095693983) so that if the counts were uniformly distributed across the reference sequence there would be one at each position (Supplementary file .hg19.bw)
|
| |
|
| Submission date |
Jun 26, 2023 |
| Last update date |
Sep 08, 2023 |
| Contact name |
Jorja Henikoff |
| E-mail(s) |
jorja@fhcrc.org
|
| Phone |
206-667-4850
|
| Organization name |
Fred Hutchinson Cancer Research Center
|
| Department |
Basic Sciences
|
| Lab |
Henikoff
|
| Street address |
1100 Fairview AV N, A1-162
|
| City |
Seattle |
| State/province |
WA |
| ZIP/Postal code |
98109-1024 |
| Country |
USA |
| |
|
| Platform ID |
GPL30173 |
| Series (1) |
| GSE235876 |
Epigenomic analysis of Formalin-Fixed Paraffin-Embedded samples by CUT&Tag |
|
| Relations |
| BioSample |
SAMN35993253 |
| SRA |
SRX20787227 |
