|
| Status |
Public on May 29, 2024 |
| Title |
06_Mock (A549_CLEAR_200_UP) |
| Sample type |
SRA |
| |
|
| Source name |
A549
|
| Organism |
Homo sapiens |
| Characteristics |
cell line: A549
cell type: lung epithelial cells
genotype: WT
treatment: Mock-infected, UV: 200mJ/cm2
molecular weight_of_purified_complexes: 115-185 kDa
ip antibody: AGO2 (clone 11A9, Merck, cat. MABE253)
|
| Treatment protocol |
Cells were either Mock or RSV-infected (MOI 0.1) for 48h, then the cells were UV crosslinked at indicated doses, cells were lysed and RNase & DNase treated, AGO2-RNA complexes were immunoprecipitated using anti-AGO2 antibody, intermolecular ligation was used to generate chimeric sequences of miRNA-target RNA, a fluorescently labelled 3'sequencing adapter was ligated and fluorescent signal was used to purify AGO2-miRNA-target complexes from an SDS-PAGE, purified complexes were proteinase K treated to remove protein before RNA extraction
|
| Growth protocol |
Cells were maintained in DMEM supplemented with 10% fetal bovine serum (FBS), 1% L-glutamine and antibiotics in humidified atmosphere with 5% CO2 at 37C
|
| Extracted molecule |
total RNA |
| Extraction protocol |
RNA was extracted using equal volume of Acid-phenol:chloroform (Ambion) followed by ethanol precipitation of the RNA
Libraries were generated using the Trilink CleanTag small RNA library kit according to manufacture's instructions, starting with the 5'adapter as the 3'adapter was ligated during the CLEAR-CLIP protocol
|
| |
|
| Library strategy |
OTHER |
| Library source |
transcriptomic |
| Library selection |
other |
| Instrument model |
Illumina NovaSeq 6000 |
| |
|
| Description |
index 6 (TriLink), seq project 11804_Buck_Amy
2022-11-08.RSV1245Mock689Igg.hsa-mature.human.18.mirnaclusters.stranded.samplecounts.annotated.targetseq.maturemirnaseq.all.GEO.csv.gz
|
| Data processing |
cutadapt with parameters: --cores 15 --minimum-length=18 --adapter=TGGAATTCTCGGGTGCCAAGGAACTCCAGTCAC
Data was processed with our lab's CLEAR-CLIP pipeline https://github.com/sujaikumar/bucklab please refer to the GitHub page and our paper to learn further details of processing
Briefly, to detect miRNA-chimeric. The first part of the read was aligned to miRBase database was made with bowtie2. Then if the second part is longer than 18 nt, this fragment gets aligned to the human genome with bowtie2, the aligned part is extracted and this is then aligned with ShortStack in order to get clusters.
The clusters are then annotated with bedtools, looking for overlaps with each of the potential annotations available. Annotations were downloaded from Gencode v34 and regulatory regions were downloaded from Ensembl. Introns were defined with AGAT.
Assembly: GRCh38.primary_assembly.genome.fa from Gencode version 34
Supplementary files format and content: csv file with chromosome coordinates for binding sites for each miRNA, additional columns include expression levels in mock or RSV conditions, overlapping genome annotations are specified as individual columns with the gene name for that feature (CDS, rRNA, tRNA, promoter, etc)
Supplementary files format and content: the file also has information about the seed binding sites for miRNAs in each loci, as well as the actual miRNA and target sequence
Library strategy: CLEAR-CLIP
|
| |
|
| Submission date |
May 17, 2023 |
| Last update date |
May 29, 2024 |
| Contact name |
José Roberto Bermúdez-Barrientos |
| E-mail(s) |
roberto89bermudez@gmail.com, beto.bermudez@ed.ac.uk, sarah.ressel@ed.ac.uk
|
| Organization name |
The University of Edinburgh
|
| Department |
Institute of Immunology & Infection
|
| Lab |
Buck Lab
|
| Street address |
Charlotte Auerbach Rd
|
| City |
Edinburgh |
| State/province |
Lothian |
| ZIP/Postal code |
EH9 3AZ |
| Country |
United Kingdom |
| |
|
| Platform ID |
GPL24676 |
| Series (2) |
| GSE232686 |
Modified CLEAR-CLIP reveals sequestration of miRNAs by Respiratory syncytial virus and functional nuclear targets of miR-27 |
| GSE232687 |
Respiratory Syncytial virus (RSV) |
|
| Relations |
| BioSample |
SAMN35130892 |
| SRA |
SRX20389248 |
