|
| Status |
Public on May 29, 2024 |
| Title |
A549 Mock-infected, 48 hpi, polyphosphatase-treated, 1 |
| Sample type |
SRA |
| |
|
| Source name |
A549
|
| Organism |
Homo sapiens |
| Characteristics |
cell line: A549
cell type: lung epithelial cells
genotype: WT
treatment: Mock infection, polyphosphatase-treated
time: 48 hpi
|
| Treatment protocol |
Cells were either Mock or RSV-infected (MOI 0.1) and cells were harvested at different time points up to 96 h post infection (hpi)
|
| Growth protocol |
Cells were maintained in DMEM supplemented with 10% fetal bovine serum (FBS), 1% L-glutamine and antibiotics in humidified atmosphere with 5% CO2 at 37C
|
| Extracted molecule |
total RNA |
| Extraction protocol |
RNA was extracted using miRNeasy kit (Qiagen), 1ug of extracted RNA was polyphosphatase-treated and 100ng were used as input for library preparation
Libraries were generated using the Trilink CleanTag small RNA library kit according to manufacture's instructions
|
| |
|
| Library strategy |
miRNA-Seq |
| Library source |
transcriptomic |
| Library selection |
size fractionation |
| Instrument model |
Illumina NovaSeq 6000 |
| |
|
| Description |
index 8, seq project 11540
46_Uninfected_48hpi
|
| Data processing |
cutadapt with parameters: --cores 15 --max-n=0 --minimum-length=18 --maximum-length=100 --adapter=TGGAATTCTCGGGTGCCAAGGAACTCCAGTCAC
quickmirseq with parameters: REFINE_MISMATACH_READS=yes, SPECIES=human
then ran the following on mapped.csv file to subset columns of interest: zcat mapped.csv.gz | perl -plne ' s/\s+//g;s/,$//;' | awk -F"," 'NR==1 || ($2==0 && $6!="")' | cut -f1,10-16 -d"," | pigz -c > quickmirseq.mapped.mirna.filtered.GEO.csv.gz
Assembly: GRCh38.primary_assembly.genome.fa
Supplementary files format and content: csv file with unique reads, their counts across libraries and the miRNA they were assigned to by quickmirseq
|
| |
|
| Submission date |
May 05, 2023 |
| Last update date |
May 29, 2024 |
| Contact name |
José Roberto Bermúdez-Barrientos |
| E-mail(s) |
roberto89bermudez@gmail.com, beto.bermudez@ed.ac.uk, sarah.ressel@ed.ac.uk
|
| Organization name |
The University of Edinburgh
|
| Department |
Institute of Immunology & Infection
|
| Lab |
Buck Lab
|
| Street address |
Charlotte Auerbach Rd
|
| City |
Edinburgh |
| State/province |
Lothian |
| ZIP/Postal code |
EH9 3AZ |
| Country |
United Kingdom |
| |
|
| Platform ID |
GPL24676 |
| Series (2) |
| GSE231784 |
Respiratory Syncytial virus (RSV) directly binds host microRNAs and de-regulates host gene targets [miRNA-seq] |
| GSE232687 |
Respiratory Syncytial virus (RSV) |
|
| Relations |
| BioSample |
SAMN34718127 |
| SRA |
SRX20233041 |
