 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Jan 30, 2024 |
| Title |
His-Flag_B |
| Sample type |
SRA |
| |
|
| Source name |
Flp-In T-Rex HEK293
|
| Organism |
Homo sapiens |
| Characteristics |
cell line: Flp-In T-Rex HEK293
genotype: WT
|
| Treatment protocol |
Expression of tagged proteins was induced by addition of tetracycline for 24 h before crosslinking. Cells were UV crosslinked using light at 254 nm as previously described (Sloan et al., 2015; Memet et al., 2017).
|
| Growth protocol |
HEK293 Flp-In T-Rex cell lines expressing GPATCH4-His-FLAG or the His-FLAG tag alone were grown at 37°C in 5% CO2 in hihg glucose DMEM supplemented with 10% foetal calf serum .
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Crosslinked RNA-protein complexes were purified under denaturing conditions and RNAs associated with His-FLAG-tagged proteins were trimmed (Bohnsack et al., 2012).
3' and 5' adapters were ligated and a cDNA library was prepared by reverse transcription and amplified by PCR (Haag et al., 2017).
|
| |
|
| Library strategy |
OTHER |
| Library source |
transcriptomic |
| Library selection |
other |
| Instrument model |
Illumina HiSeq 4000 |
| |
|
| Data processing |
Sequencing reads for each experimental sample were demultiplexed using their 5' barcode sequences NNNNNAGC. Using pyBarcode Filter (pyCRAC version 1.4.5).
3' adaptor sequences (TGGAATTCTCGGGTGCCAAGG) were removed using Flexbar (version 3.5.0). flexbar', '-r', , '-t', '-q', 'TAIL', '-qf', u'i1.8', '-qt', '13', '-u', '0', '-m', '21', '-n', '8', '-at', 'RIGHT', '-z', 'GZ', '-o', '-ao', '2', '-ae', '0.1', '-as'
Identical sequence reads containing the same UMI were collapsed using pyFastqDuplicateRemover (PyCRAC version 1.4.5).
Aligment STAR (version 2.7.0d):params=' --runThreadN 8 --alignEndsType EndToEnd --outFilterMismatchNoverLmax 0.3 --outFilterMultimapScoreRange 10 --outReadsUnmapped Fastx --outSAMtype BAM SortedByCoordinate --outFilterMultimapNmax 60 --outSAMunmapped Within --outFilterScoreMinOverLread 0 --outFilterMatchNminOverLread 0 --outFilterMatchNmin 15 --alignSJDBoverhangMin 1000 --alignIntronMax 1 --outWigType wiggle --outWigStrand Stranded --outWigNorm RPM --readFilesCommand zcat '
Bedgraphs were generated using bedtools (version 2.27.1) with the following arguments genomecov -ibam .bg
Assembly: Homo_sapiens.GRCh38.29
Supplementary files format and content: Aligned reads in bedgraph format
Library strategy: CRAC
|
| |
|
| Submission date |
Apr 24, 2023 |
| Last update date |
Jan 30, 2024 |
| Contact name |
Katherine Bohnsack |
| E-mail(s) |
katherine.bohnsack@med.uni-goettingen.de
|
| Organization name |
University Medical Centre Göttingen
|
| Street address |
Humboldtallee 23
|
| City |
Göttingen |
| ZIP/Postal code |
37073 |
| Country |
Germany |
| |
|
| Platform ID |
GPL20301 |
| Series (2) |
| GSE230431 |
GPATCH4 regulates rRNA and snRNA 2’-O-methylation in both DHX15-dependent and -independent manners [CRAC] |
| GSE230433 |
GPATCH4 regulates rRNA and snRNA 2'-O-methylation in both DHX15-dependent and -independent manners |
|
| Relations |
| BioSample |
SAMN34353588 |
| SRA |
SRX20084022 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM7221981_His-Flag_B.bedgraph.gz |
6.0 Mb |
(ftp)(http) |
BEDGRAPH |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data provided as supplementary file |
|
|
|
|
 |
