 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Jan 23, 2025 |
| Title |
ALPHA-mouse-IL4-cd22-2A |
| Sample type |
SRA |
| |
|
| Source name |
spleen
|
| Organism |
Mus musculus |
| Characteristics |
tissue: spleen
cell type: IL4c treated CD22+ Tvm
genotype: BALB/cJ
treatment: IL-4 complex treatment
|
| Treatment protocol |
IL-4c treatment consisted in the administration of combined recombinant mouse IL-4 (5ug, Biolegend) with monoclonal anti-IL-4 antibody (11B11 clone, 25ug, Biolegend) at day -4 and at day -2 intrapertioneally in 100 uL sterile PBS. H. polygyrus infection consisted in the administration by oral gavage of 200 uL distilled water containing 200 infectious L3 larvae.
|
| Extracted molecule |
other |
| Extraction protocol |
scRNA-seq: spleen or mesLN tissue were harvested and cells were dissociated using PBS, scissors and syringe plunger on a 40um cell strainer. After washing, cells were counted and CD8+ T cells were enriched using negative selection Mojo Sort magnetic beads (Biolegend). mesLN cells were further stained to detect CD124+ and CD124- CD8+ T cells (anti-CD124-BV421, anti-CD8-FITC, anti-CD44-PECy7, anti-TCRb-BV711, DAPI), cells and sorted using a FACS Aria uIII (BD Biosciences). Then cells were tagged using mouse multiplexing HashTags 1 to 6 (TotalSeq, Biolegend) or using Mouse multiplexing Sample Tag 1 and 2 (BD Biosciences) before pooled were made. Cell capture was performed using 10X Genomics Chromium controller (spleen samples) or using the BD Rhapsody scanner and express (mesLN).
RNA-seq and TCR-seq: spleens were harvested and cells were dissociated using PBS, scissors and syringe plunger on a 40um cell strainer. After washing, cells were counted and CD8+ T cells were enriched using negative selection Mojo Sort magnetic beads (Biolegend). Enriched CD8+ T cells were further stained using (anti-CXCR3-BV421, anti-CD8-FITC, anti-CD44-PECy7, anti-TCRb-BV711, anti-CD49d-BV650, anti-CD22-PE, DAPI) and subpopulations sorted using a FACS Aria uIII (BD Biosciences) for each individual mouse (200,000 cells per mouse). Then, total RNA was extracted using the RNeasy micro kit (Qiagen) and eluted in 14 uL of distilled RNAse-free water before stored at -80°C for less then 2 weeks. RNA integrity was analysed using a 2100 Bioanalyzer (Agilent).
scRNA-seq: Chromium Single Cell 3’ v3 chemistry (10X Genomics) or BD Rhapsody Whole Transcriptome Analysis cDNA synthesis (BD Biosciences)
RNA-seq: SMART-seq HT cDNA synthesis kit (Takara)
TCR-seq: template-switch anchored RT-PCR using oligodT during the cDNA generation and the following mouse-specific Cα and Cβ primers for the PCR amplification: TRAC ‘5-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGTCCTGAGACCGAGGATCTTT and TRBC ‘5-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGGGTAGCCTTTTGTTTGTTTG (adapters in italic)
|
| |
|
| Library strategy |
OTHER |
| Library source |
other |
| Library selection |
other |
| Instrument model |
Illumina MiSeq |
| |
|
| Description |
TRA chain
|
| Data processing |
10X Genomics: The demultiplexing, barcoded processing, gene counting and aggregation were made using the Cell Ranger software v3.0.2 (https://support.10xgenomics.com/single-cell-gene-expression/software/pipelines/latest/what-is-cell-ranger)
Hashtags 10X Genomics: Processing of the HTO samples was performed using CITEseq-Count,
Bulk RNAseq: Basecalling performed using Illumina bcl2fastq v2.20 Sequenced reads were trimmed for adaptor sequence, and masked for low-complexity or low-quality sequence Reads were processed for mapping and quantification using nf-core rnaseq pipeline v3.0.0 (https://nf-co.re/rnaseq/3.0/usage ) and using Gene set from Ensembl.org release 102.
BD Rhapsody : Data were processed using rhapsody_wta_2.0b2 pipeline ( https://bitbucket.org/CRSwDev/cwl/src/master/v2.0b2/ ) from BD Genomics.
Assembly: GRCm38
Supplementary files format and content: Tab-separated values files and matrix files
Library strategy: TCR-seq
|
| |
|
| Submission date |
Mar 30, 2023 |
| Last update date |
Jan 23, 2025 |
| Contact name |
Arnaud Lavergne |
| Organization name |
University of Liège
|
| Department |
GIGA
|
| Street address |
Avenue de l'hôpital 11
|
| City |
Liège |
| State/province |
Liège |
| ZIP/Postal code |
4000 |
| Country |
Belgium |
| |
|
| Platform ID |
GPL16417 |
| Series (1) |
| GSE228564 |
IL-4 induces CD22 expression to restrain the effector program of self-reactive virtual memory T cells |
|
| Relations |
| BioSample |
SAMN33988019 |
| SRA |
SRX19821482 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM7124148_converted.clones_IL4_cd22_2A.txt.gz |
124.9 Kb |
(ftp)(http) |
TXT |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data provided as supplementary file |
|
|
|
|
 |
