NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Sample GSM7124123 Query DataSets for GSM7124123
Status Public on Jan 23, 2025
Title HTO-WT-IL4C
Sample type SRA
 
Source name spleen
Organism Mus musculus
Characteristics tissue: spleen
cell type: CD8+ T cells
genotype: Il4ra-lox/lox BALB/c
treatment: IL-4 complex treatment
Treatment protocol IL-4c treatment consisted in the administration of combined recombinant mouse IL-4 (5ug, Biolegend) with monoclonal anti-IL-4 antibody (11B11 clone, 25ug, Biolegend) at day -4 and at day -2 intrapertioneally in 100 uL sterile PBS. H. polygyrus infection consisted in the administration by oral gavage of 200 uL distilled water containing 200 infectious L3 larvae.
Extracted molecule other
Extraction protocol scRNA-seq: spleen or mesLN tissue were harvested and cells were dissociated using PBS, scissors and syringe plunger on a 40um cell strainer. After washing, cells were counted and CD8+ T cells were enriched using negative selection Mojo Sort magnetic beads (Biolegend). mesLN cells were further stained to detect CD124+ and CD124- CD8+ T cells (anti-CD124-BV421, anti-CD8-FITC, anti-CD44-PECy7, anti-TCRb-BV711, DAPI), cells and sorted using a FACS Aria uIII (BD Biosciences). Then cells were tagged using mouse multiplexing HashTags 1 to 6 (TotalSeq, Biolegend) or using Mouse multiplexing Sample Tag 1 and 2 (BD Biosciences) before pooled were made. Cell capture was performed using 10X Genomics Chromium controller (spleen samples) or using the BD Rhapsody scanner and express (mesLN).
RNA-seq and TCR-seq: spleens were harvested and cells were dissociated using PBS, scissors and syringe plunger on a 40um cell strainer. After washing, cells were counted and CD8+ T cells were enriched using negative selection Mojo Sort magnetic beads (Biolegend). Enriched CD8+ T cells were further stained using (anti-CXCR3-BV421, anti-CD8-FITC, anti-CD44-PECy7, anti-TCRb-BV711, anti-CD49d-BV650, anti-CD22-PE, DAPI) and subpopulations sorted using a FACS Aria uIII (BD Biosciences) for each individual mouse (200,000 cells per mouse). Then, total RNA was extracted using the RNeasy micro kit (Qiagen) and eluted in 14 uL of distilled RNAse-free water before stored at -80°C for less then 2 weeks. RNA integrity was analysed using a 2100 Bioanalyzer (Agilent).
scRNA-seq: Chromium Single Cell 3’ v3 chemistry (10X Genomics) or BD Rhapsody Whole Transcriptome Analysis cDNA synthesis (BD Biosciences)
RNA-seq: SMART-seq HT cDNA synthesis kit (Takara)
TCR-seq: template-switch anchored RT-PCR using oligodT during the cDNA generation and the following mouse-specific Cα and Cβ primers for the PCR amplification: TRAC ‘5-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGTCCTGAGACCGAGGATCTTT and TRBC ‘5-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGGGTAGCCTTTTGTTTGTTTG (adapters in italic)
 
Library strategy RNA-Seq
Library source other
Library selection cDNA
Instrument model Illumina NovaSeq 6000
 
Description 10X Genomics
Hashtags
Data processing 10X Genomics: The demultiplexing, barcoded processing, gene counting and aggregation were made using the Cell Ranger software v3.0.2 (https://support.10xgenomics.com/single-cell-gene-expression/software/pipelines/latest/what-is-cell-ranger)
Hashtags 10X Genomics: Processing of the HTO samples was performed using CITEseq-Count,
Bulk RNAseq: Basecalling performed using Illumina bcl2fastq v2.20 Sequenced reads were trimmed for adaptor sequence, and masked for low-complexity or low-quality sequence Reads were processed for mapping and quantification using nf-core rnaseq pipeline v3.0.0 (https://nf-co.re/rnaseq/3.0/usage ) and using Gene set from Ensembl.org release 102.
BD Rhapsody : Data were processed using rhapsody_wta_2.0b2 pipeline ( https://bitbucket.org/CRSwDev/cwl/src/master/v2.0b2/ ) from BD Genomics.
Assembly: GRCm38
Supplementary files format and content: Tab-separated values files and matrix files
 
Submission date Mar 30, 2023
Last update date Jan 23, 2025
Contact name Arnaud Lavergne
Organization name University of Liège
Department GIGA
Street address Avenue de l'hôpital 11
City Liège
State/province Liège
ZIP/Postal code 4000
Country Belgium
 
Platform ID GPL24247
Series (1)
GSE228564 IL-4 induces CD22 expression to restrain the effector program of self-reactive virtual memory T cells
Relations
BioSample SAMN33988044
SRA SRX19821433

Supplementary file Size Download File type/resource
GSM7124123_HTO-WT-IL4C_barcodes.tsv.gz 46.3 Kb (ftp)(http) TSV
GSM7124123_HTO-WT-IL4C_features.tsv.gz 115 b (ftp)(http) TSV
GSM7124123_HTO-WT-IL4C_matrix.mtx.gz 182.3 Kb (ftp)(http) MTX
SRA Run SelectorHelp
Raw data are available in SRA
Processed data provided as supplementary file

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap