|
| Status |
Public on Mar 11, 2024 |
| Title |
B6_WT_mTEC_GFP_RNA_rep1 |
| Sample type |
SRA |
| |
|
| Source name |
Thymus
|
| Organism |
Mus musculus |
| Characteristics |
tissue: Thymus
cell type: Aire-GFP+ mTECs
genotype: WT
age: 4-6 weeks old
Sex: Female
strain: C57BL/6J
treatment: NA
|
| Treatment protocol |
mTECs were isolated by collagenase and dispase digestion, CD45+ cells depletion using magnetic beads, fluorescent antibodies staining, and flow sorting.
|
| Extracted molecule |
total RNA |
| Extraction protocol |
For each sample, 1000 cells were sorted directly into the lysis buffer [5uL TCL buffer (Qiagen) supplemented with 1% 2-mercaptoethanol (Sigma)]. Total RNA was purified using RNAClean XP beads (Beckman Coulter). Polyadenylated mRNA was selected using an anchored oligo(dT) primer (5′–AAGCAGTGGTATCAACGCAGAGTACT30VN-3) and then reverse transcribed to cDNA. First-strand cDNA was subjected to limited PCR amplification followed by Tn5 transposon-based fragmentation using the Nextera XT DNA Library Preparation Kit (Illumina).
Libraries were constructed following the Smart-seq2 RNA-seq library preparation protocol.
|
| |
|
| Library strategy |
RNA-Seq |
| Library source |
transcriptomic |
| Library selection |
cDNA |
| Instrument model |
Illumina NextSeq 500 |
| |
|
| Data processing |
For non-F1-hybrid RNA-seq, paired-end RNA-seq reads were aligned to the mm10 genome using STAR. Non-uniquely mapped reads were discarded. The uniquely mapped reads were assigned to genes using featureCounts with GENCODE annotation (vM25). TPM (Transcripts Per Million) values for genes were output by Kallisto (‘quant’, v0.45.1).
For F1-hybrid RNA-seq experiments, quality control was performed using Sickle (default setting, v1.33) to remove low-quality reads. Paired-end RNA-seq reads were aligned to the corresponding reference or alternative genome using Tophat2 (v2.1.1). Only paired-end reads mapped to the single unique genomic location were kept for downstream analysis (SAMtools, v1.3.1).
Assembly: mm10 and NOD/ShiLtJ
Supplementary files format and content: *kallisto.tsv: output file of kallisto 'quant' function
Supplementary files format and content: *genes_count.tsv: gene count table
|
| |
|
| Submission date |
Feb 05, 2023 |
| Last update date |
Mar 11, 2024 |
| Contact name |
CBDM Lab |
| E-mail(s) |
cbdm@hms.harvard.edu
|
| Phone |
617-432-7747
|
| Organization name |
Harvard Medical School
|
| Department |
Microbiology and Immunobiology
|
| Lab |
CBDM
|
| Street address |
77 Avenue Louis Pasteur
|
| City |
Boston |
| State/province |
MA |
| ZIP/Postal code |
02215 |
| Country |
USA |
| |
|
| Platform ID |
GPL19057 |
| Series (2) |
| GSE224556 |
Z-DNA underlies the target choice of Aire by facilitating promoter poising [RNA-seq] |
| GSE224557 |
Z-DNA underlies the target choice of Aire by facilitating promoter poising |
|
| Relations |
| BioSample |
SAMN33097567 |
| SRA |
SRX19285474 |
