|
| Status |
Public on Feb 18, 2011 |
| Title |
Multiplex Rep 1 Sfg1 Insertions |
| Sample type |
SRA |
| |
|
| Source name |
His+ FOAr colonies
|
| Organism |
Saccharomyces cerevisiae |
| Characteristics |
strain: MATa /MATα his3∆1/ his3∆1 leu2∆0/ leu2∆0 ura3∆0/ ura3∆0 met15∆0/MET15 LYS2/lys2∆0 sir4::KanMX/ sir4::KanMX trp1::Hyg/ trp1::Hyg
|
| Growth protocol |
Yeasts were grown in complete synthetic media with the addition of 2% glucose or galactose.
|
| Extracted molecule |
genomic DNA |
| Extraction protocol |
Calling Card Illumina libraries were prepared by harvesting all His+ FOAr colonies and extracting their genomic DNA. Each DNA sample was divided into three aliquots and digested with Hinp1I or HpaII or TaqI. Digested DNA was ligated overnight at 15°C in dilute solution (<10ng/ul) to encourage self-circularization. After ethanol precipitation, self-ligated DNA was resuspended in ddH2O and used as template in an inverse PCR. Primers that anneal to Ty5 sequences (OM8714: AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTAATTCACTACGTCAACA; OM8827: CAAGCAGAAGACGGCATACGAGATCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATC) were used to amplify the genomic regions flanking Ty5 integrations and the bar codes within Ty5, as well as adding adapter sequences that allow the PCR products to be sequenced on the Illumina GA II analyzer. The PCR products were purified using the QIAquick PCR Purification Kit (Qiagen) and diluted to 10nM. For each sample, the same amount of PCR product from digestion with each restriction endonuclease was pooled and submitted for sequencing on the Illumina GAII. The average insert size of the Paired-end libraries was 79.25 bp.
|
| |
|
| Library strategy |
ChIP-Seq |
| Library source |
genomic |
| Library selection |
ChIP |
| Instrument model |
Illumina Genome Analyzer II |
| |
|
| Description |
Insertions of Ty5 containing the Sfg1 barcode in the 1st Multiplex replicate
|
| Data processing |
Paired-end DNA sequence reads were filtered by requiring the correct 17 bp LTR sequence in the first 17 bases of sequence from the first paired-end read, and an appropriate 5 bp barcode sequence and restriction enzyme digestion site sequence on the second paired-end read. Paired reads were mapped using a seeded hash approach. The first 12 genomic bases of each read were mapped to the yeast genome. The remaining genomic fragments of each read were then aligned to the seeds using an ungapped alignment and allowing up to 2 mismatches on each read. All alignments from the first read are compared to all alignments from the second read and screened for 3 requirements: (1) same chromosome, (2) within 1200 base-pairs, and (3) opposite strands. If a matched read pair passes all these tests it is accepted as a Calling Card insertion site. If multiple matched read pairs meet these requirements, the pair with the fewest cumulative mismatches in the alignment is accepted as an insertion site. If there is a tie and multiple pairs have the same minimum number of mismatches the read is discarded. Single-end DNA reads were filtered by requiring the correct 17 bp LTR in the first half of the read and the remaining genomic bases were queried against 16-mer hash table of the yeast genome. Only insertions with unique reads were accepted. Genome build: NCBI Saccharomyces cerevisiae S288c (2006)
|
| |
|
| Submission date |
Feb 17, 2011 |
| Last update date |
May 15, 2019 |
| Contact name |
David Mayhew |
| E-mail(s) |
david.n.mayhew@gsk.com
|
| Organization name |
GlaxoSmithKline
|
| Department |
Target Sciences, Computation Biology, R&D
|
| Street address |
1250 South Collegeville Road
|
| City |
Collegeville |
| State/province |
PA |
| ZIP/Postal code |
19426 |
| Country |
USA |
| |
|
| Platform ID |
GPL9377 |
| Series (1) |
| GSE27381 |
Multiplexed identification of the genomic targets of DNA-binding proteins |
|
| Relations |
| SRA |
SRX043829 |
| BioSample |
SAMN00216169 |