 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Sep 07, 2023 |
| Title |
12K MPRA experiment on the mouse liver (3prime library, enhancer-barcode assignments) |
| Sample type |
SRA |
| |
|
| Source name |
Plasmid library
|
| Organism |
synthetic construct |
| Characteristics |
cell line: Plasmid library
genotype: pSA293-CHEQseq-3'BC
|
| Growth protocol |
Culture of HepG2 cells: The HepG2 cell line was purchased from ATCC (HB-8065). HepG2 cells were cultured in Eagle’s Minimum Essential Medium (EMEM, Thermo Fisher Scientific) supplemented with 10% fetal bovine serum (Thermo Fisher Scientific) and 50 µg/mL penicillin/streptomycin (Thermo Fisher Scientific). Cell cultures were kept at 37°C, with 5% CO2.
|
| Extracted molecule |
genomic DNA |
| Extraction protocol |
Enhancer library cloning: The pSA293-CHEQseq plasmid (Addgene 174669), containing a SCP1 promoter, a chimeric intron and the Venus cDNA, was used as a reporter plasmid for MPRA. Two different versions of that plasmid were used for the cloning of the 12k library: pSA293-CHEQseq-5’BC contains a random 17 bp barcode (BC) upstream of the chimeric intron and pSA293-CHEQseq-3’BC-1 contains a random 17 bp BC between the Venus and the poly(A) tail. The oligonucleotide libraries were resuspended according to the manufacturer’s recommendation and amplified via PCR with the primers ‘CHEQ_liver_For’ and ‘CHEQ_liver_Rev’. To clone the amplified enhancer library upstream of the SCP1 promoter, the vectors were linearized via inverse PCR with primers ‘CHEQ_lin_For’ and ‘CHEQ_lin_Rev’. Amplified libraries and the corresponding linearized vector were combined in an NEBuilder reaction with a vector to insert ratio of 1:5. The NEBuilder reactions were dialyzed against water in a 6 cm Petri dish with a membrane filter MF-Millipore 0.05 µm (Merck, Kenilworth, NJ) for 1 hr. Reactions were recovered from the membrane, and 2.5 µL of the reaction was transformed into 25 µL of Lucigen Endura ElectroCompetent Cells (Biosearch Technologies, Hoddesdon, UK). Before culture for maxiprep, 1:100,000 of the transformed bacteria was plated on an LB-agar dish with carbenicillin to estimate the complexity of the cloned library. A volume of bacteria corresponding to a complexity of 500 BCs per enhancer was put in culture for maxiprep. Maxiprep was performed with the Nucleobond Xtra endotoxin-free maxiprep kit (Macherey-Nagel). Bulk MPRA in vitro: The MPRA libraries were transfected in HepG2 cells by use of the Lipofectamine 3000 reagent (Thermo Fisher Scientific). Briefly, 4 million HepG2 cells were seeded in a 10 cm cell culture dish. The next day, when cells reach 70-90% confluency, a tube A with 500 µL opti-MEM (Thermo Fisher Scientific) and 25 µL Lipofectamine 3000 reagent and a tube B with 500 µL opti-MEM and 15 µL of the liver enhancer library were prepared and incubated for 5 min at RT. Tube B was mixed carefully with tube A and incubated for 15 min at RT. The medium of the HepG2 cells was also changed to opti-MEM medium and finally the mixture was added dropwise to the cells. 48 hours post-transfection, cells were detached from the plate using trypsin (Thermo Fisher Scientific). One-fifth of the cells was used for plasmid DNA extraction (Qiagen). The remaining cells were used for RNA extraction using the innuPREP RNA Mini Kit 2.0 (Analytik Jena), followed by mRNA isolation using the Dynabeads mRNA purification kit (Ambion) and cDNA synthesis using the GoScript RT Kit and oligo dT primer (Promega). To amplify the random 5’ and 3’ BC from the plasmid DNA or cDNA sample, a PCR was performed for 16 cycles with ‘CHEQseq_barcode_5’_For’, ‘CHEQseq_barcode_5’_Rev’ and ‘CHEQseq_barcode_3’_For’, ‘CHEQseq_barcode_3’_Rev’, respectively. To add Illumina sequencing adaptors, all samples were finally amplified by PCR for 6 cycles with the primers ‘i5_Indexing_For’ and ‘i7_Indexing_Rev. Bulk MPRA in vivo: For intrahepatic delivery of the liver MPRA libraries, 8- to 10-week-old mice were secured and hydrodynamically injected with 20 µg of the libraries via the lateral tail vein. All libraries were diluted in sterile filtered 0.9% NaCl, and the total volume was adjusted to 10% (in mL) of the total body weight (in grams). 24 hours post-injection, mice were anesthetized by intraperitoneal injection of sodium pentobarbital (Nembutal, 50 mg/kg) and whole livers were isolated. Liver tissues were homogenized by using M tubes (Miltenyi Biotec) and the GentleMACS Dissociator (Miltenyi Biotec). RNA and plasmid DNA extraction, mRNA purification and cDNA prep, and barcode amplification, were done as described for MPRA in vitro.
For the liver library cloned in the pSA293-CHEQseq-5’BC plasmid, a PCR amplification (12 cycles) of the enhancer, together with the random BC, was done with the primers ‘Enh_BC_5’_For’ and ‘Enh_BC_5’_Rev'. Illumina sequencing adaptors were added during a second round of PCR with the primers ‘i5_Indexing_For’ and ‘i7_Indexing_Rev’. Before sequencing, the fragment size of every library was analyzed using the Bioanalyzer high-sensitivity chip. All libraries were sequenced on a NextSeq2000 instrument (Illumina) with the following sequencing parameters: 51 bp read 1 – 8 bp index 1 – 8 bp index 2 – 51 bp read 2. For the liver libraries cloned in the pSA293-CHEQseq-3’BC plasmids, we performed Nanopore sequencing as follows. A total of 1.5 µg of the library was linearized by digestion with NcoI according to the manufacturer’s protocol. We next processed 200 ng of the cleaned up and linearized plasmid with an Oxford Nanopore Technologies Q20+ ligation sequencing kit early-access SQK-LSK112 following the manufacturer’s protocol (Genomic DNA by Ligation; revision GDE_9141_v112_revC_01Dec2021). A total amount of 10 fmol of the prepared library was loaded onto a MinION R10.4 flow cell and sequenced for at least 72 hr (MinKNOW ≥ v21.11.09).
|
| |
|
| Library strategy |
OTHER |
| Library source |
genomic |
| Library selection |
other |
| Instrument model |
MinION |
| |
|
| Description |
3p_Nanopore assignments
|
| Data processing |
For the 5' enhancer-barcode assignments reads were first processed with fastqc (v0.11.8) to assess their quality, and then trimmed using cutadapt with options -g TGTCCCCAGTGCAAGTGCAG --discard-untrimmed -m 12 -l 12 for read 1 to extract the enhancer barcode and options -g AATTAATTCGGGCCCCGGTCC...GATCGGCGCGCCTGCTCG -j 10 --discard-untrimmed -m 17 -M 17 for read 2 to extract the plasmid barcode. For read 2, we then used seqkit (v0.10.2), with options seq -r -p, to get the reverse complement sequence. Reads were filtered to keep only those with quality > 30 using fastp (v0.20.0). This resulted in 8,835,050 enhancer-barcode assignments for the 5’ 12K library, with 78.3% barcodes assigned to a unique enhancer. For the 3' enhancer-barcode assignments, Raw signal fast5 files were re-basecalled using Guppy v6.0.7 using the super-accuracy model (dna_r10.4_e8.1_sup). To process the reads, we first generated a synthetic genome consisting of the plasmid sequence (with 100bp flanks) with all possible enhancers inserted. Reads were mapped using minimap2 (v2.22) with options -ax map-ont –secondary=no -N 1 -f 500 and a bam file was generated using SAMTools (v1.11). Next, we used the R package GenomicAlignments (v1.24.0) to extract the sequences overlapping the enhancer sequence and the enhancer barcodes from the reads and calculate the number of mismatches. This resulted in a library with 723,805 unique enhancer-barcode assignments, with 85.5% barcodes assigned to a unique enhancer. CHEQ-seq barcodes were extracted from the plasmid and cDNA samples (read 2) using cutadapt with parameters with options -g TTATCATGTCTGCTCGAAGC...GATCGGCGCGCCTGCTCG --discard-untrimmed -m 17 -M 17 and seqkit (v0.10.2), with options seq -r -p, was used to get the reverse complement sequence. Reads were filtered to keep only those with quality > 30 using fastp (v0.20.0). Reads were assigned to enhancers based on the corresponding enhancer-barcode assignments, resulting in a count matrix with number of reads per enhancer and sample.
Assembly: mm10
Supplementary files format and content: 12K_MPRA_counts.tsv: Tab-separated text file containing bulk MPRA samples as columns, tested enhancers as rows and assigned reads per sample as value.
Library strategy: CHEQ-seq
|
| |
|
| Submission date |
Nov 21, 2022 |
| Last update date |
Sep 07, 2023 |
| Contact name |
Carmen Bravo Gonzalez-Blas |
| Organization name |
VIB-KU Leuven Center for Brain & Disease Research
|
| Street address |
Herestraat 49
|
| City |
Leuven |
| ZIP/Postal code |
3000 |
| Country |
Belgium |
| |
|
| Platform ID |
GPL25738 |
| Series (2) |
| GSE218471 |
Enhancer grammar of liver cell types and hepatocyte zonation states [12K_MPRA] |
| GSE218472 |
Enhancer grammar of liver cell types and hepatocyte zonation states |
|
| Relations |
| BioSample |
SAMN31821781 |
| SRA |
SRX18333971 |
| Supplementary data files not provided |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data are available on Series record |
|
|
|
|
 |
