 |
 |
GEO help: Mouse over screen elements for information. |
|
Status |
Public on Sep 02, 2011 |
Title |
miRNA-Seq analysis of peripheral mononuclear cell from TC014 (m00734) |
Sample type |
SRA |
|
|
Source name |
m00734-1
|
Organism |
Homo sapiens |
Characteristics |
submitted sample id: JOC68-RNA donor_id: TC014 Sex: male body site: Blood histological type: Peripheral blood mononuclear cell is tumor: No biomaterial_type: primary cell cell_type: Peripheral blood mononuclear cell
|
Extracted molecule |
total RNA |
Extraction protocol |
library construction protocol: Refer to document 'miRNA3 - Plate Format miRNA Library Construction' from BC at the Roadmap Epigenomics Project site, Experimental Protocols page (URL: http://www.roadmapepigenomics.org/protocols/type/experimental/)
|
|
|
Library strategy |
miRNA-Seq |
Library source |
transcriptomic |
Library selection |
size fractionation |
Instrument model |
Illumina Genome Analyzer IIx |
|
|
Description |
design description: miRNA-Seq analysis of peripheral mononuclear cell from TC014 (m00734) using Illumina Genome Analyzer IIx library name: m00734 EXPERIMENT_TYPE: smRNA-Seq EXTRACTION_PROTOCOL: Total RNA was extracted using Trizol from Invitrogen as per manufacturer's instructions. LIBRARY_GENERATION_PCR_POLYMERASE_TYPE: Phusion DNA Polymerase (Hot Start), 2U/ul (from NEB) LIBRARY_GENERATION_PCR_THERMOCYCLING_PROGRAM: step1: 98C for 30sec, step2: 98C for 10sec, step3: 60C for 30sec, step4: 72C for 15sec. Repeat step2-4 for 15 cycles, 72C for 5min. LIBRARY_GENERATION_PCR_NUMBER_CYCLES: 15 LIBRARY_GENERATION_PCR_F_PRIMER_SEQUENCE: 5' AATGATACGGCGACCACCGACAGNNNNNNGTTCAGAGTTCTACAGTCCGA 3' LIBRARY_GENERATION_PCR_R_PRIMER_SEQUENCE: 5' CAAGCAGAAGACGGCATACGAGAT 3' LIBRARY_GENERATION_PCR_PRIMER_CONC: 25 uM LIBRARY_GENERATION_PCR_PRODUCT_ISOLATION_PROTOCOL: 28uL of PCR products containing unique index sequences are pooled together and the 115bp miRNA containing fraction is isolated for each pool either manually: 12% PAGE gel 200V 6hours followed by gel elution, or robotically using Baraccuda size selection robot. Fractions are Et0H preciptated, QCed on Agilent, and submitted for indexing single end (ISE) Illumina sequencing. EXTRACTION_PROTOCOL_SMRNA_ENRICHMENT: Flowthrough of polyA+ MultiMACS 96 Separation Unit SMRNA_PREPARATION_INITIAL_SMRNA_QLTY: RIN N/A SMRNA_PREPARATION_INITIAL_SMRNA_QNTY: N/A ug RNA_PREPARATION_5'_RNA_ADAPTER_SEQUENCE: 5' GTTCAGAGTTCTACAGTCCGACGATCTGGTCAA 3' RNA_PREPARATION_3'_RNA_ADAPTER_SEQUENCE: 5' ATCTCGTATGCCGTCTTCTGCTTGT 3' RNA_PREPARATION_REVERSE_TRANSCRIPTION_PRIMER_SEQUENCE: 5' CAAGCAGAAGACGGCATACGAGAT 3' RNA_PREPARATION_3'_RNA_ADAPTER_LIGATION_PROTOCOL: 1ug of total RNA (RN =>7.0) in a 4uL volume and 2uL of 3' Adenylated Adapter was heat denatured at 70C for 2min then snap chilled on ice for 1min. Then 1uL of 10X T4 RNL2 truncated buffer, 0.8uL 100mM MgCl2, 0.2uL DEPC water, 0.5uL Rnase Out, and 1.5uL T4 RNA Ligase 2 trancated was added. Ligation incubated at 22C in a Tetrad thermocycler for 60min. RNA_PREPARATION_5'_RNA_ADAPTER_LIGATION_PROTOCOL: 5' RNA adapter was heat denatured at 70C for 2min then snap chilled on ice. 2uL of denatured 5' RNA Adapter was added to the 3' DNA Adapter Ligation reaction product from previous step and mixed. Then 1uL of 10mM ATP and 1uL of Ambion T4 RNA Ligase were added and ligation reaction was incubated at 37C in a Tetrad thermocycler for 60min. RNA_PREPARATION_REVERSE_TRANSCRIPTION_PROTOCOL: To the 14uL of double adaptered miRNA product from previous step 2ul of RT-Primer was added and the mixture was heat denatured at 65C for 10 mins then quenched on ice. The following reagents were added immediately to the sample (6ul of 5X First Strand Buffer, 2ul of 10mM dNTPs , 3ul of 100mM DTT, 1ul of RNaseOUT, and 2uL of SuperScript II RT. Reaction was heated at 44C in a Thetrad thermocycler for 60 minutes. LIBRARY_GENERATION_PCR_TEMPLATE: 15ul of the first strand cDNA product was used in the PCR **************** For data usage terms and conditions, please refer to: http://www.drugabuse.gov/funding/funding-opportunities/nih-common-fund/epigenomics-data-access-policies ****************
|
Data processing |
**********************************************************************
ANALYSIS FILE NAME: GSM669582_UCSF-UBC.Peripheral_Blood_Mononuclear_Primary_Cells.smRNA-Seq.TC014.bed ANALYSIS CENTER: EDACC ANALYSIS ALIAS: M00734-1.hg19.level.1.release4 ANALYSIS TITLE: Mapping of Peripheral Blood Mononuclear Primary Cells smRNA-Seq Data ANALYSIS DESCRIPTION: Illumina reads produced by smRNA-Seq on Peripheral Blood Mononuclear Primary Cells, Donor TC014 were mapped to the human genome using Pash. ANALYSIS TYPE: REFERENCE_ALIGNMENT EDACC Genboree Analysis Page: http://genboree.org/java-bin/project.jsp?projectName=XML%20Submissions%2FEDACC%2FANALYSIS%2FEDACC.9529 DATA_ANALYSIS_LEVEL: 1 EXPERIMENT_TYPE: smRNA-Seq GENOME_ASSEMBLY: NCBI Build GRCh37/UCSC Build hg19 SOFTWARE: Pash SOFTWARE_VERSION: 3.0 MAXIMUM_ALIGNMENT_LENGTH: Read length MISMATCHES_ALLOWED: 10% of read length ALIGNMENTS_ALLOWED: 100 TREATMENT_OF_MULTIPLE_ALIGNMENTS: If a read maps to more than 100 positions it is removed from consideration. TREATMENT_OF_IDENTICAL_ALIGNMENTS_OF_MULTIPLE_READS: None ALIGNMENT_POSTPROCESSING: None RELEASE_NUMBER: Human Epigenome Atlas 4
QUALITY SCORES: NUMBER_OF_MAPPED_READS: 1,330,677 PERCENT_READS_MAPPING_TO_miRBase_v16_miRNA: 49.06 PERCENT_READS_MAPPING_TO_miRBase_v16_miRNA_PERCENTILE: 13 MAXIMUM_REPLICATE_CORRELATION: NA
**********************************************************************
ANALYSIS FILE NAME: GSM669582_UCSF-UBC.Peripheral_Blood_Mononuclear_Primary_Cells.smRNA-Seq.TC014.tag.tab ANALYSIS CENTER: EDACC ANALYSIS ALIAS: M00734-1.hg19.level.2.tag ANALYSIS TITLE: Sequence Tag Counts of Peripheral Blood Mononuclear Primary Cells smRNA-Seq Data ANALYSIS DESCRIPTION: Illumina reads produced by smRNA-Seq on Peripheral Blood Mononuclear Primary Cells, Donor TC014 had the sequence trimmed for adapters and the count of unique sequences calculated. ANALYSIS TYPE: ABUNDANCE_MEASUREMENT EDACC Genboree Analysis Page: http://genboree.org/java-bin/project.jsp?projectName=XML%20Submissions%2FEDACC%2FANALYSIS%2FEDACC.9544 DATA_ANALYSIS_LEVEL: 2 EXPERIMENT_TYPE: smRNA-Seq GENOME_ASSEMBLY: NCBI Build GRCh37/UCSC Build hg19 SOFTWARE: In house programs and scripts SOFTWARE_VERSION: NA RELEASE_NUMBER: Human Epigenome Atlas 4
QUALITY SCORES: NUMBER_OF_MAPPED_READS: 1,330,677 PERCENT_READS_MAPPING_TO_miRBase_v16_miRNA: 49.06 PERCENT_READS_MAPPING_TO_miRBase_v16_miRNA_PERCENTILE: 13 MAXIMUM_REPLICATE_CORRELATION: NA
**********************************************************************
ANALYSIS FILE NAME: GSM669582_UCSF-UBC.Peripheral_Blood_Mononuclear_Primary_Cells.smRNA-Seq.TC014.wig ANALYSIS CENTER: EDACC ANALYSIS ALIAS: M00734-1.hg19.level.2.release.4 ANALYSIS TITLE: Raw Signal Density Graphs of Peripheral Blood Mononuclear Primary Cells smRNA-Seq Data ANALYSIS DESCRIPTION: Illumina smRNA-Seq read mappings from Peripheral Blood Mononuclear Primary Cells, Donor TC014 were processed into density graphs of raw signal representing the aligned read density. If a read maps to more than one location, the density of that read at a specific location is calculated as 1/(number of mappings). ANALYSIS TYPE: ABUNDANCE_MEASUREMENT EDACC Genboree Analysis Page: http://genboree.org/java-bin/project.jsp?projectName=XML%20Submissions%2FEDACC%2FANALYSIS%2FEDACC.9559 DATA_ANALYSIS_LEVEL: 2 EXPERIMENT_TYPE: smRNA-Seq GENOME_ASSEMBLY: NCBI Build GRCh37/UCSC Build hg19 SOFTWARE: In house programs and scripts SOFTWARE_VERSION: NA READ_EXTENSION: 0bp GENOMIC_WINDOW: 20bp TREATMENT_OF_REGIONS_PRONE_TO_MULTIPLE_ALIGNMENTS: None RELEASE_NUMBER: Human Epigenome Atlas 4 BROWSER_TRACK_NAME: PBM smRNA 14 BROWSER_TRACK_DESCRIPTION: UCSF-UBC-USC Peripheral Blood Mononuclear Primary Cells smRNA-Seq Donor TC014 Library M00734-1 EA Release 4
QUALITY SCORES: NUMBER_OF_MAPPED_READS: 1,330,677 PERCENT_READS_MAPPING_TO_miRBase_v16_miRNA: 49.06 PERCENT_READS_MAPPING_TO_miRBase_v16_miRNA_PERCENTILE: 13 MAXIMUM_REPLICATE_CORRELATION: NA
**********************************************************************
|
|
|
Submission date |
Feb 07, 2011 |
Last update date |
May 15, 2019 |
Contact name |
UCSF-UBC CENTER |
Organization name |
UCSF-UBC
|
Street address |
UCSF-UBC
|
City |
San Francisco |
State/province |
CA |
ZIP/Postal code |
94143 |
Country |
USA |
|
|
Platform ID |
GPL10999 |
Series (1) |
GSE16368 |
UCSF-UBC Human Reference Epigenome Mapping Project |
|
Relations |
Reanalyzed by |
GSE99453 |
Named Annotation |
GSM669582_UCSF-UBC.Peripheral_Blood_Mononuclear_Primary_Cells.smRNA-Seq.TC014.wig.gz |
SRA |
SRX1157936 |
BioSample |
SAMN03416733 |
Supplementary file |
Size |
Download |
File type/resource |
GSM669582_UCSF-UBC.Peripheral_Blood_Mononuclear_Primary_Cells.smRNA-Seq.TC014.bed.gz |
6.5 Mb |
(ftp)(http) |
BED |
GSM669582_UCSF-UBC.Peripheral_Blood_Mononuclear_Primary_Cells.smRNA-Seq.TC014.tag.tab.gz |
727.6 Kb |
(ftp)(http) |
TAB |
GSM669582_UCSF-UBC.Peripheral_Blood_Mononuclear_Primary_Cells.smRNA-Seq.TC014.wig.gz |
2.0 Mb |
(ftp)(http) |
WIG |
SRA Run Selector |
Processed data provided as supplementary file |
Raw data are available in SRA |
|
|
|
|
 |