GEO Accession viewer

NCBI > GEO > Accession Display

Not logged in | Login

GEO help: Mouse over screen elements for information.

Sample GSM6617295

Query DataSets for GSM6617295

Status

Public on Oct 26, 2022

Title

Aortic CD45+, WT and myeloid JAK2-V617F, ADT

Sample type

SRA

Source name

Aorta

Organism

Mus musculus

Characteristics

tissue: Aorta
cell line: not applicable
cell type: CD45+
genotype: WT and Myeloid JAK-V617F
treatment: none

Extracted molecule

protein

Extraction protocol

Jak2WT (n=5) and Jak2V617F MyC (n=5) mice under isoflurane anesthesia received 2µg of anti-CD45.2-APC (clone 104, BioLegend) i.v. 5 minutes before sacrifice to label circulating immune cells and were killed by cervical dislocation. Upon collection of the aorta using a stereomicroscope, aneurysm development was macroscopically detected in 2 Jak2V617F MyC mice. Aortas were collected and enzymatically digested in RPMI medium containing 450U/ml collagenase I (Sigma-Aldrich C0130), 125U/ml collagenase XI (Sigma-Aldrich C7657), 60U/ml Hyaluronidase (Sigma-Aldrich H3506) and 60U/ml DNAse1 (Roche #11284932001) for 45 minutes at 37°C with agitation, washed in PBS+1% FCS and passed through a 70µm cell strainer. After washing in PBS+1%FCS, aortic cells were resuspended in erythrocyte lysis buffer (ACK buffer) for 5 minutes and washed again with PBS+1% FCS. Cells were plated in round bottom 96 well plates, and incubated for 10 minutes on ice with anti-CD16/32 (BioLegend, Clone 93, 10µg/ml in PBS+1% FCS) to block unspecific binding of antibodies to Fc receptors. Cells were subsequently labeled in a final volume of 60µl for 25 minutes at 4°C with a mix containing CITE-seq antibodies (TotalSeq-A, BioLegend), 1:1000 Fixable Viability Dye e780 (ThermoFisher Scientific 65-0865-14), 2µg/ml anti-CD45.2 BV421 (Jak2WT samples) or 2µg/ml anti-CD45.2 Alexa488 (Jak2V617F samples). Each unique sample was labeled with a specific Hashtag antibody for cell hashing (Hashtag 1 to 5: Jak2WT aortas, Hashtag 7 and 9: Jak2V617F MyC with aneurysm; Hashtag 6, 8 and 10: Jak2V617F MyC without aneurysm; final concentration 1:100, BioLegend TotalSeq-A). After labeling, cells were washed twice in PBS+1% FCS and pooled. Viable leukocytes were sorted with exclusion of contaminating circulating leukocytes (CD45.2-APC+) using a BD FACS Aria III with a 100µm nozzle. The amount of sorted cells was adjusted so that cells from Jak2WT (CD45.2-BV421+) and from Jak2V617F aortas (CD45.2-Alexa488+) each represented ~50% of the total sorted cells. Cells were sorted in PBS supplemented with 1% PBS, and washed twice post-sort in PBS+0.04% UltraPure BSA (ThermoFisher AM2616). Cells were counted in Trypan blue to assess viability (>80%). 20,000 cells were loaded at a concentration of 500 cells/µl in the 10x Genomics Chromium (Single Cell 3’ v3 reagents, 10x Genomics) and scRNA-seq, ADT and HTO libraries were prepared and sequenced.
Library was prepared using Chromium Single Cell 3ʹ v2 protocol (10x Genomics). Cellular mRNA and antibody-derived oligos were reverse-transcribed and indexed with a shared cellular barcode. Indexed cDNAs were then pooled and amplified by PCR according to the Chromium Single Cell 3’ v2 protocol (10x Genomics) and with specific primers amplifying the antibody-derived tags. SPRI bead size selection was performed in order to separate both the mRNA-derived cDNA (>300bp) and the antibody-derived tagged cDNAs (180bp). For the mRNA derived cDNA library preparation, we further proceeded according to the manufacturer’s instructions for Single Cell 3’ v2 protocol (10x Genomics). For antibody-derived tagged library, we used the KAPA HiFI HotStart Library Amplification Kit (Roche) with the following primers and amplification program:
-CITE-seq library: amplification was performed at 95°C for 3’ followed by ten cycles at 95°C f¬¬or 20’’; 60°C for 30’’; 72°C for 20’’ and final elongation 72°C for 5’ with 5’-CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA-3’ Small RNA RPI1 primer as i7 primer (Illumina).
-HASH-seq library: amplification was performed at 95°C for 3’ followed by ten cycles 95°C for 20’’; 64°C for 30’’; 72°C for 20’’ and final elongation 72°C for 5’ with 5’-CAAGCAGAAGACGGCATACGAGATCGAGTAATGTGACTGGAGTTCAGACGTGTGC-3’ TruSeq D701_s primer as i7 primer (Illumina).
The following 5’- AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTC-3’ SI-PCR primer as i5 primer (Illumina) was used for both CITE- and HASH- seq library amplification.
Following the final bead purification, all three libraries were pooled as 80% mRNA library, 10% ADT library and 10% HTO library before sequencing.

Library strategy

OTHER

Library source

other

Library selection

other

Instrument model

Illumina NovaSeq 6000

Description

Antibody-derived oligonucleotide library: read1 file contains cell barcode and UMI; read2 file contains Antibody Derived Tag reads
Antibody-derived oligonucleotide (ADT)

Data processing

Pre-processing of sequencing results to generate count matrices (gene expression, ADT and HTO barcode counts) was performed using the 10x genomics Cell Ranger pipeline where ADT and HTO sequences were concatenated and treated as Custom library with default settings (v3.0.2) and aligning to the mm10 genome build and Ensembl 93 annotations.
Further processing was done with Seurat v3.0.0 (cell and gene filtering, hashtag identification, clustering, differential gene expression analysis).
Assembly: mm10
Supplementary files format and content: 10x Genomics output files: barcodes.tsv.gz, features.tsv.gz, matrix.mtx.gz
Library strategy: CITE-seq (Cellular Indexing of Transcriptomes and Epitopes by sequencing)

Submission date

Oct 05, 2022

Last update date

Oct 26, 2022

Contact name

Antoine-Emmanuel Saliba

E-mail(s)

emmanuel.saliba@helmholtz-hzi.de

Phone

+49-931-31-81341

Organization name

Helmholtz Institute for RNA-based Infection Research