|
| Status |
Public on Dec 31, 2022 |
| Title |
CD21-Cre AtrC/KD_1460 |
| Sample type |
SRA |
| |
|
| Source name |
B cells
|
| Organism |
Mus musculus |
| Characteristics |
cell type: anti-CD40 and Il4 activated B cells
genotype: CD21-Cre AtrC/KD
strain: BL6
|
| Treatment protocol |
Cells were cultured for 4 days and analyzed via flow cytometry before DNA extraction.
|
| Growth protocol |
Purified splenic B (CD43-) cells from mice were cultured in RPMI mediume with cytokines (anti-CD40 (1 ng/mL; BD Pharmingen) and IL-4 (20 ng/mL; R&D)).
|
| Extracted molecule |
genomic DNA |
| Extraction protocol |
Genomic DNA was extracted from day 4 cultured B cells.
Libraries were prepared according to protocol in (Hu J, et al. Nat Protoc 11:853–871.(2016)) Linear amplifications were performed using Sμ-specific biotin primer 5′/5BiosG/CAGACCTGGGAATGTATGGT3′) and followed by nesting PCR with (5′CACACAAAGACTCTGGACCTC3′) AflII is used to remove germ-line sequence.
high-throughput genome translocation sequencing (HTGTS). Sequenced with MiSeq 500v
|
| |
|
| Library strategy |
OTHER |
| Library source |
genomic |
| Library selection |
other |
| Instrument model |
Illumina MiSeq |
| |
|
| Data processing |
library strategy: high-throughput genome translocation sequencing (HTGTS)
Basecalls performed using Illumina RTA version 1.18.54
Miseq reads was first de-multiplexed by fastq-multx tool from ea-util, then adaptor sequence was further trimmed with SeqPrep utility.
Pre-processed reads were then mapped to customized mm9 genome using Bowtie2. The best-path searching algorithm (related to YAHA; ref. 50) was used to identify optimal sequence alignments from Bowtie2-reported top alignments (alignment score > 50).
The reads are then filtered to exclude mispriming events, germ-line (unmodified) sequence, sequential joints, and duplicated reads. A “duplicate read” is defined by bait and prey alignment coordinates within 2 nt of another read’s bait and prey alignments. To plot all of the S-region junctions, including those in the repeats but unequivocally mapped to an individual switch region, we combined the ones filtered by a mappability filter but unequivocally mapped to S regions with “good” reads passing both the mappability (both deduplicated) filters (please see ref. 28 for simulation and details on plotting). MHs are defined as regions of 100% homology between the bait and prey-break site. Insertions are defined as regions containing nucleotides that map to neither the bait and prey-break site. Blunt junctions are considered to have no MHs or insertions.
Assembly: mm9
Supplementary files format and content: .xlsx files generated from tab-delimited text files after analysis for reads distribution
|
| |
|
| Submission date |
Aug 28, 2022 |
| Last update date |
Dec 31, 2022 |
| Contact name |
Shan Zha |
| E-mail(s) |
sz2296@cumc.columbia.edu
|
| Organization name |
Columbia University
|
| Street address |
1130 Saint Nicholas Ave.
|
| City |
New York |
| State/province |
NY |
| ZIP/Postal code |
10032 |
| Country |
USA |
| |
|
| Platform ID |
GPL16417 |
| Series (2) |
| GSE212195 |
ATR kinase supports normal proliferation in the early S phase by preventing replication resource exhaustion [HTGTS] |
| GSE212196 |
ATR kinase supports normal proliferation in the early S phase by preventing replication resource exhaustion. |
|
| Relations |
| BioSample |
SAMN30548456 |
| SRA |
SRX17293827 |
