 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Oct 24, 2022 |
| Title |
HeLa_polyA_WT_IVT_rep2 |
| Sample type |
SRA |
| |
|
| Source name |
HeLa_polyA_WT_IVT_rep2
|
| Organism |
Homo sapiens |
| Characteristics |
cell type: HeLa
treatment: TadA8.20
genotype: wild type
library type: in vitro transcribed RNA
|
| Treatment protocol |
FTO-, FTO+ and IVT RNA samples were deaminated on beads with 200 pmol of TadA8.20 in the deamination buffer (50 mM Tris, 25 mM KCl, 2.5 mM MgCl2, 2 mM dithiothreitol, and 10 % (v/v) glycerol; pH 7.5) supplemented with 10% (v/v) of SUPERase•In RNase Inhibitor (Invitrogen, AM2696) at 53ºC for 1 h. This reaction was repeated twice at 44ºC, 1h each by draining the supernatant on a magnetic rack and resuspending the beads in fresh reaction mixtures, lasting 3 h in total. The beads were washed sequentially by resuspension in 0.1% PBST (v/v), 1× Binding/Wash buffer, and twice in 10 mM Tris HCl (pH 7.5).
|
| Growth protocol |
Human HeLa cell line and wild-type (WT) mouse embryonic stem cells (mESC) were purchased from ATCC. HeLa cell line was grown in DMEM (Gibco, 11965092) media supplemented with 10% FBS (Gibco) and 1% 100× Pen/Strep (Gibco). mESCs were maintained in DMEM (Invitrogen) supplemented with 15% FBS (Gibco), 1% nucleosides (100×) (Millipore), 1 mM L-glutamine (Gibco), 1% nonessential amino acids (Gibco), 0.1 mM 2-mercaptoethanol (Sigma), 1,000 U/ml LIF (Millipore), 3 μM CHIR99021 (Stemcell), and 1 μM PD0325901 (Stemcell). All cells were cultured at 37°C under 5.0% CO2. Mettl3 cKO mES cell lines were generated following previously reported methods (PMID: 31949099). Briefly, mESCs derived from Mettl3flox/flox mouse blastocyst were transfected with 200 ng PB-CAG-Puromycin-P2A-CreERT2 and 100 ng PBase by electroporation. After 24 h, electroporated cells were treated with 1 μg/ml Puromycin to generate stable Mettl3flox/flox; CreERT2 mES clones. To induce deletion, Mettl3flox/flox; CreERT2 ESC cells were treated with 1 μg/ml 4-hydroxytamoxifen (Sigma). These Mettl3 KO cells were cultured for 48 h before harvesting. Untreated Mettl3flox/flox; CreERT2 ESC cells were used as ctrl mESCs.
|
| Extracted molecule |
polyA RNA |
| Extraction protocol |
Cells were cultured to 70-80% confluency, rinsed with 1× PBS (Gibco), and lysed by the direct addition of TRIzol reagent (Invitrogen). Total RNA was then collected following the manufacturer’s protocol. Poly A+ RNA was extracted from purified total RNA using Dynabeads mRNA DIRECT Purification Kits (Invitrogen). Modification-free control RNAs were prepared from HeLa or mESC total RNA according to a previously published protocol (PMID: 34594034, 32518404).
RNA was annealed to 2 pmol of RT primer (AGACGTGTGCTCTTCCGATCT) at 70ºC for 2 min, then reverse transcribed in 1× RT buffer (Thermo Scientific, EP0753, containing 50 mM Tris-HCl, pH 8.3; 75 mM KCl, 3 mM MgCl2, 10 mM DTT) with 5 mM of RNaseOUT (Invitrogen, 10777019) and 200 U of Maxima H- Reverse Transcriptase (Thermo Scientific, EP0753) at 50ºC for 1h. The cDNA was released by boiling the beads in 0.5% (v/v) SDS for 10 min. The eluate was purified by DNA Clean & Concentrator (Zymo) kits. Purified cDNA was ligated to cDNA Adapter (/5Phos/NNNNNN AGATCGGAAGAGCACACGTCTG/3SpC3/) using 30 U of T4 RNA ligase (NEB) at 25ºC overnight, following a previously published protocol (PMID: 35288668). The reaction was purified again by DNA Clean & Concentrator (Zymo) kits and then PCR amplified with NEBNext Ultra II Q5 Master Mix (NEB, M0544X) and NEBNext Unique Dual Index Primer for Illumina (NEB, E6440S) following the manufacturer’s directions. Typically, 10-11 cycles of PCR were carried out to generate enough DNA. The resulting library was purified by AMPure XP beads (Beckman Coulter, A63882) following the manufacturer’s directions and submitted for next-generation sequencing.
|
| |
|
| Library strategy |
RNA-Seq |
| Library source |
transcriptomic |
| Library selection |
cDNA |
| Instrument model |
Illumina NovaSeq 6000 |
| |
|
| Description |
HeLa_polyA_WT_IVT_rep2
|
| Data processing |
Adapters of all raw eTAM-seq data sets were removed by Cutadapt v1.18. The six-nt-long random barcodes in the 5’ end of R2 reads were extracted by the subcommand extract from UMI-tools v1.1.1. R2 reads longer than 39 nt were used for further analysis. For HeLa cells, reads were first mapped to the human rRNA sequences using HISAT-3N v2.2.1. Then unmapped reads were mapped to the human genome (hg38) and the GENCODE v27 gene annotation. For mESCs, reads were first mapped to the mouse rRNA sequences using HISAT-3N. Then unmapped reads were mapped to the mouse genome (mm10) and the GENCODE vM25 gene annotation. Only uniquely mapped reads were remained and then subjected to deduplication by the subcommand dedup from UMI-tools. Reads with > 50% unconverted A were eliminated. Finally, custom scripts were used to count converted and unconverted As for each genomic positions.Site-specific quantification was estimated by the model developed in this study.
Assembly: hg38, mm10
Supplementary files format and content: m6A sites with accessibility and methylation levels in the plain txt format
|
| |
|
| Submission date |
Aug 15, 2022 |
| Last update date |
Oct 24, 2022 |
| Contact name |
Shun Liu |
| Organization name |
University of Chicago
|
| Department |
Chemistry
|
| Lab |
Chuan He Lab
|
| Street address |
929 E. 57th. Street
|
| City |
Chicago |
| State/province |
IL |
| ZIP/Postal code |
60637 |
| Country |
USA |
| |
|
| Platform ID |
GPL24676 |
| Series (2) |
| GSE201064 |
Transcriptome-wide profiling and quantification of N6-methyladenosine by enzyme-assisted adenosine deamination |
| GSE211303 |
Transcriptome-wide profiling and quantification of N6-methyladenosine by enzyme-assisted adenosine deamination [eTAM-seq] |
|
| Relations |
| BioSample |
SAMN30324091 |
| SRA |
SRX17085470 |
| Supplementary data files not provided |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data are available on Series record |
|
|
|
|
 |
