 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Jan 02, 2025 |
| Title |
ChIPSeq_P7_Testis_ZBTB16_rabbit_rep2 |
| Sample type |
SRA |
| |
|
| Source name |
Mouse testis
|
| Organism |
Mus musculus |
| Characteristics |
cell type: Mouse testis at P7
chip antibody: ZBTB16 (SCBT, #sc-22839)
age: P7
chip antibody: Zbtb16 (SCBT, #sc-22839)
|
| Extracted molecule |
genomic DNA |
| Extraction protocol |
Tissues/THY1+ uSPGs were fixed with 1% formaldehyde for 10 minutes. After quenching and cell lysis, chromatin was sonicated using a Branson sonifier (0.9 s on/0.1 s off x 7 cycles, average size 300-700 bp).
ChIP-seq libraries were prepared using the NEBNext® ChIP-Seq Library Prep Master Mix Set for Illumina. 10 ng of DNA was used as starting material for input and ip samples. Libraries were size selected at 250-450bp in length using Agencourt AMPure XP beads from Beckman Coulter. Libraries were amplified using 7 cycles on the thermocycler. Libraries were validated using the Agilent High Sensitivity DNA Kit
|
| |
|
| Library strategy |
ChIP-Seq |
| Library source |
genomic |
| Library selection |
ChIP |
| Instrument model |
Illumina HiSeq 2500 |
| |
|
| Description |
13665X10
|
| Data processing |
ChIP-seq reads were aligned to the mouse reference genome (mm10) using the Novoalign (http://novocraf.com) with the parameters: -o SAM -r Random -H -a AGATCGGAAGAGCACACGTCTGAACTCCAGTCA including adapter sequence removal.
We removed PCR duplicates and all unmapped reads for fair comparison between all datasets using Picard MarkDuplicates (version 2.7.1)
Peak calling was performed using USeq8.9.6 packages and MACS (2.1.1) with the default parameters.
Peaks with -10log10(q-Value) (QValFDR) greater than 30 (q<0.001) for USeq and 20 (q<0.01) for MACS were included for downstream analyses.
bigWig files were generated using the USeq package and MACS2. Score represents the normalized coverage of DNA fragments at a given genomic coordinate. only peaks from the merged files of two/three replicates overlapped with at least 50% of peaks from the union of biological replicates were considered for the merged replicates, using BEDTools intersect with parameters: -u -f 0.5.
Assembly: mm10
Supplementary files format and content: bigWig, peaks, narrowPeak (except for Input sample)
|
| |
|
| Submission date |
May 12, 2022 |
| Last update date |
Jan 02, 2025 |
| Contact name |
Bradley R. Carins |
| E-mail(s) |
brad.cairns@hci.utah.edu
|
| Phone |
8015851822
|
| Organization name |
University of Utah
|
| Department |
Oncological Sciences
|
| Lab |
Cairns Lab
|
| Street address |
2000 Circle of Hope
|
| City |
Salt Lake City |
| State/province |
UT |
| ZIP/Postal code |
84112 |
| Country |
USA |
| |
|
| Platform ID |
GPL17021 |
| Series (2) |
| GSE202818 |
ZBTB16/PLZF regulates self-renewal and differentiation of spermatogonial stem cells through an extensive transcription factor-chromatin poising network |
| GSE202819 |
ZBTB16/PLZF regulates juvenile spermatogonial stem cell development via an extensive transcription factor poising network |
|
| Relations |
| BioSample |
SAMN28202756 |
| SRA |
SRX15241097 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM6133827_ChIPSeq_P7_Testis_Zbtb16_rabbit_rep2.bw |
29.0 Mb |
(ftp)(http) |
BW |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data provided as supplementary file |
|
|
|
|
 |
