 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Jul 15, 2022 |
| Title |
DSB RAFT HEK293T rep2 |
| Sample type |
SRA |
| |
|
| Source name |
HEK293T
|
| Organism |
Homo sapiens |
| Characteristics |
cell line: HEK293T
tissue: kidney
age: embryo
genotype: wild type
|
| Treatment protocol |
The cells were cultured in Dulbecco’s modified Eagle medium (DMEM) supplemente+B29d with 10% FBS penicillin (100 U/ml), streptomycin (100ug/ml) and L-glutamine (4 mM).
|
| Growth protocol |
HEK 293 cells were seeded in 10 cm culture plates 1-2 days before experiment in DMEM containing 10% FBS, and used at approximately 60-80% confluency.
|
| Extracted molecule |
genomic DNA |
| Extraction protocol |
About 6 millions of HEK293T cells in 2 ml of culture medium were pelleted by centrifugation at 2000 rpm, resuspended in 0.3 ml of the same medium, gently mixed at 42°C with an equal volume of a 1% agarose L (LKB) in PBS solution, and distributed on a mold containing 100-microliters wells. The mold was placed on ice for 2-5 min, covered with parafilm. The agarose plugs were then placed in Petri dishes with 5 ml of solution containing 0.5 M EDTA (pH 9.5), 1% sodium laurylsarcosine, and 1-2 mg of proteinase K solution per ml for 40-48 hr at 50°C, and stored at 4°C in the same solution. Each DNA-agarose plus usually contained about 15 microgramms of DNA corresponding to about 1 millions of cells. To test the quality of isolated DNA the fractionation in the pulsed-field gels. Portions of the original agarose-DNA plugs (5-50 microliters) containing 1-10 microgramms of DNA were used for electrophoresis without any restriction enzyme digestion. The DNA samples were run in 0.8% agarose gels on an LKB Pulsaphor system using hexagonal electrode and switching times of 25 or 450 sec. For elution of DNA preparations the fractionation in 1% agarose conventional mini-gel was performed. One-half of DNA-agarose plug was washed in 1xTE 3 times (for 15 min each) following by 3 times washing in the same solution containing 17.4 microgramms/ml PMSF in ethanol. After fractionation in the mini-gel, the ethidium-bromide stained DNA band was excised and electoeluted inside the dialysis cellulose membrane bag. After overnight dialysis without stirring against 1 liter of 0.01 x TE at 4°C, the DNA was concentrated with PEG (4°C) and redialyzed. Library preparation: About 1.5 microgramms of isolated DNA, forum DNA, (see above) was ligated with 70 ng of double-stranded oligonucleotide containing EcoRI and PstI sites (25 bp long 5’-phosphorylated 5’ pCCCCTGCAGTATAAGGAGAATTCGGG 3’ oligonucleotide annealed with 26 bp long 5’ biotinylated 5’ bio-CCGAATTCTCCTTATACTGCAGGGG 3’ oligonucleotide) in 150 microliters of solution containing 0.1 M NaCl, 50 mM Tris HCl (pH 7.4), 8 mM MgCl2, 9 mM 2-mercaptoethanol, 7 microM ATP, 7.5 % PEG, and 40 units of T4 DNA ligase at 20°C for 16 hr. After heating at 65°C for 10 min the DNA preparation was digested with Sau3A enzyme to shorten the forum domain to the termini attached to the ligated oligonicleotide. The selection of such termini was performed in 0.5 ml eppendorf tubes using 300 microliters of suspension containing streptavidin magnespere paramagnetic particles, SA-PMP (Promega) according to the manufacturer's recommendations. After extensive washing with 0.5xSSC removing DNA fragments corresponding to internal parts of forum domains, the forum termini (FT) DNA preparation was eluted from the SA-PMP using digestion with EcoRI enzyme in final volume of 50?mictolitres (double-stranded FT). The FT were then ligated with 100x molar excess of double-stranded Sau3A adaptor (5’-phosphorylated 5’ pGATCGTTTGCGGCCGCTTAAGCTTGGG 3’ oligonucleotide annealed with 5’ CCCAAGCTTAAGCGGCCGCAAAC 3’ oligonucleotide). In some experiments (FT) DNA preparation was eluted from the SA-PMP using heating by incubation at 100°C for 3 min in 50 microliters of 0.01xTE (single-stranded FT). Before heating the FT preparation was ligated with100x molar excess of double-stranded Sau3A adaptor in suspension with SA-PMP (see above). Both final DNA samples (double-stranded FT or single-stranded FT) were used for PCR amplifications. 40 cycle PCR amplification in 30 microlitersl of a solution containing 67 mM Tris-HCl (pH 8.4); 6 mM MgCl2; 10 mM 2-mercaptoethanol; 16.6 mM ammonium sulfate; 6.7 microM EDTA; 5 microg/ml BSA; 1 mM dNTPs; 1 microg of primer corresponding to Sau3A adaptor (5’ CCCAAGCTTAAGCGGCCGCAAAC 3’); 1 microg of primer corresponding to biotinilated oligonucleotide (5’ CCGAATTCTCCTTATACTGCAGGGG 3’) and 1 u of Taq polymerase was performed using Eppendorf Mastercycler Personal. Amplification conditions were 90°C for melting, 65°C for annealing and 72°C for extension, for 1 min each.
Both final DNA samples (double-stranded FT or single-stranded FT) were used for PCR amplifications. 40 cycle PCR amplification in 30 microlitersl of a solution containing 67 mM Tris-HCl (pH 8.4); 6 mM MgCl2; 10 mM 2-mercaptoethanol; 16.6 mM ammonium sulfate; 6.7 microM EDTA; 5 microg/ml BSA; 1 mM dNTPs; 1 microg of primer corresponding to Sau3A adaptor (5’ CCCAAGCTTAAGCGGCCGCAAAC 3’); 1 microg of primer corresponding to biotinilated oligonucleotide (5’ CCGAATTCTCCTTATACTGCAGGGG 3’) and 1 u of Taq polymerase was performed using Eppendorf Mastercycler Personal. Amplification conditions were 90°C for melting, 65°C for annealing and 72°C for extension, for 1 min each. Deep sequencing of libraries were performed using HiSeq1500 (Illumina) in Paired-End mode using 100-nt long reads.
|
| |
|
| Library strategy |
OTHER |
| Library source |
genomic |
| Library selection |
other |
| Instrument model |
Illumina HiSeq 1500 |
| |
|
| Description |
Replicate 2
|
| Data processing |
Base calling and quality control were performed in real time with standard Illumina analysis pipeline using a phiX control.
EcoRI/PstI primer was ligated to DSBs sites, so sequenced reads were trimmed from EcorI/PstI primer sequence and low quality/too short sequences by cutadapt v. 3.5 using the following options: --trim-n --times=5 --minimum-length=20 --quality-cutoff=26 --discard-untrimmed --pair-filter=both -g CCGAATTCTCCTTATACTGCAGGGG -G CCGAATTCTCCTTATACTGCAGGGG. This options ensure that read have EcorI/PstI 5' adapter at the any of reads, and thus, contains DSB. All other reads have been eliminated.
At the next step all already trimmed sequences were trimmed from all possible combinations of 5' and/or 3' adapters: -a CCCAAGCTTAAGCGGCCGCAAACX -a GTTTGCGGCCGCTTAAGCTTGGGX -a CCCCTGCAGTATAAGGAGAATTCGGX -g XCCCAAGCTTAAGCGGCCGCAAAC -g XGTTTGCGGCCGCTTAAGCTTGGG -g XCCCCTGCAGTATAAGGAGAATTCGG -A CCCAAGCTTAAGCGGCCGCAAACX -A GTTTGCGGCCGCTTAAGCTTGGGX -A CCCCTGCAGTATAAGGAGAATTCGGX -G XCCCAAGCTTAAGCGGCCGCAAAC -G XGTTTGCGGCCGCTTAAGCTTGGG -G XCCCCTGCAGTATAAGGAGAATTCGG
At the last adapter removal step we removed all incomplete 5' and/or 3' adapters: -g file:5adapters.fa -G file:5adapters.fa -a file:3adapters.fa -A file:3adapters.fa -a CCCCTGCAGTATAAGGAGAATTCGG -A CCCCTGCAGTATAAGGAGAATTCGG.
Trimmed reads were mapped to hg19p13 by bwa 0.7.17-r1188 using the mem algorithm. All non-aligned reads were removed from resulting alignment file by samtools 1.14 with -F 4 option.
Mapping and alignment results were converted to resulting tables using samtools 1.14 and ad hoc Perl scripts.
bedtools intersectBed 2.29.1 was applied to find and remove exact intersections (parameters -v -f 1.0) between each replicate and low complexity and/or repeat regions from the DFAM database. At the next step, intersections between replicates were found by intersectBed again. In-house Perl scripts were used to convert the resulting file to bedGraph format and to add to it sequences by coordinates from the reference genome. BEDOPS 2.4.40 bedmap, partition as well as Linux awk were used to merge the bedGraph genome tracks with intersected segments.
All data processing steps were performed for H.sapiens hg38p12 build too.
Assembly: Homo Sapiens hg19/GRCh37.p13 genome with included to chr14 from address 1 Human ribosomal DNA U13369
Assembly: Homo Sapiens hg38/GRCh38.p12 genome with included to chr14 from address 1 Human ribosomal DNA U13369
Supplementary files format and content: Tab-delimited text file include the following features of each mapping: begin, end, length, coverage, number of reads, sequence. bedGraph files for intersection are supplied too.
Library strategy: DNA-seq
|
| |
|
| Submission date |
Apr 28, 2022 |
| Last update date |
Jul 15, 2022 |
| Contact name |
Nickolai Tchurikov |
| E-mail(s) |
tchurikov@eimb.ru
|
| Organization name |
Engelhardt Institute of Molecular Biology
|
| Department |
Department of Epigenetic Mechanisms of Gene Expression Regulation
|
| Street address |
32, Vavilova str.
|
| City |
Moscow |
| ZIP/Postal code |
119991 |
| Country |
Russia |
| |
|
| Platform ID |
GPL18460 |
| Series (1) |
| GSE201829 |
Genome-wide analysis of DSBs sites in HEK293T cells |
|
| Relations |
| BioSample |
SAMN27961521 |
| SRA |
SRX15044221 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM6073760_DSB_HEK293T_hg19.rep2.txt.gz |
127.1 Mb |
(ftp)(http) |
TXT |
| GSM6073760_DSB_HEK293T_hg38.rep2.txt.gz |
128.9 Mb |
(ftp)(http) |
TXT |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data provided as supplementary file |
| Processed data are available on Series record |
|
|
|
|
 |
