|
| Status |
Public on Apr 19, 2022 |
| Title |
E6_MII_BTG4_Het_paiso |
| Sample type |
SRA |
| |
|
| Source name |
Oocyte
|
| Organism |
Mus musculus |
| Characteristics |
genotype: Btg4 Het
developmental stage: MII oocyte
molecule: Poly(A) tail length
|
| Extracted molecule |
total RNA |
| Extraction protocol |
To obtain oocytes or preimplantation embryos, 8-weeks-old or 5-weeks-old C57BL/6 female mice were intraperitoneally injected with pregnant mare’s serum gonadotropin (PMSG; 5 IU) and human chorionic gonadotrophin (hCG; 5 IU). Preimplantation embryos were collected from 5-weeks-old C57BL/44 female mice mated with PWK/PhJ male mice.
Total RNA was extracted by TRIzol (life tech; 15596018) and further purified through isopropanal precipitation and resolved in 11 μl nuclease-free water. Total RNA is used for end extension with dU-containing end extension oligos by Klenow fragment (3'→ 5' exo-, NEB; M0212L). The end-extended RNAs (>200 nt) was cleaned up by RNA Clean & Concentrator-5 kit (Zymo; R1015) and eluted by 7 μl nuclease-free water. The cleaned RNA was reverse transcribed by SuperScript II similar to Smart-seq2 method. The amplified DNA was size selected by Ampure beads and made into SMRTbell Template library. The libraries were sequenced by Pacbio sequel II.
|
| |
|
| Library strategy |
OTHER |
| Library source |
transcriptomic |
| Library selection |
other |
| Instrument model |
Sequel II |
| |
|
| Description |
E6_polyAtaillength_merge.txt
|
| Data processing |
Ribo-lite reads were trimmed with cutadapt v1.14 with parameters: cutadapt --trim-n -a GATCGGAAGAGCACACGTCTG -a AGAGCACACGTCTG <input.file> | cutadapt -u 3 -a A{100} --no-indels -e 0.16666666666666666 - | cutadapt -O 8 --match-read-wildcards -g GTTCAGAGTTCTACAGTCCGACGATCSSS -m 18 - -o <output.file> , and the trimmed reads were sequentially mapped to mouse/human rRNAs sequences (mm9/hg19) using Bowtie2 v2.2.2 with parameters --seedlen=23. Those aligned to rRNA were discarded, and the rest reads were mapped to transcriptome of mm9/hg19 using STAR v2.5.3a with parameters --outFilterMismatchNmax 2 --outFilterMultimapNmax 20 --outFilterMatchNmin 16 --alignEndsType EndToEnd. The gene expression level was then calculated by Cufflinks v2.2.1 based on the annotation of CDS region。
All mRNA-seq data were trimmed by Trim Galore v0.4.2 then mapped to transcriptome of mm9/hg19 by STAR v2.5.3a with parameters --outFilterMultimapNmax 20 --outSAMstrandField intronMotif. The gene expression level was calculated by Cufflinks v2.2.1.
After sequencing, CCS reads were extracted. The CCS reads were further split into different samples based on barcode and trimmed into clean reads. (The uploaded data are splitted and trimmed already). The clean reads were aligned to the mm9 genome using minimap. The poly(A) tail length of each transcript was calculated by the length of the clipped sequence. The poly(A) tail length of a gene was presented by the genomic mean of the poly(A) tail length of all the transcript as described44. For MII poly(A) tail length analysis, we merged WT and Btg4+/- data as MII control poly(A) tail length data to increase data depth after confirming their similarity.
Assembly: mm9
Library strategy: PAIso-seq
|
| |
|
| Submission date |
Apr 07, 2022 |
| Last update date |
Apr 19, 2022 |
| Contact name |
Zhuqing Xiong |
| E-mail(s) |
lexizqxiong@gmail.com
|
| Organization name |
School of Life Science, Tsinghua Univers
|
| Street address |
Haidian District
|
| City |
Beijing |
| State/province |
FOREIGN |
| ZIP/Postal code |
100084 |
| Country |
China |
| |
|
| Platform ID |
GPL29177 |
| Series (1) |
| GSE165782 |
Ultrasensitive Ribo-seq reveals translational landscapes during mammalian oocyte-to-embryo transition and pre-implantation development |
|
| Relations |
| BioSample |
SAMN27404720 |
| SRA |
SRX14778620 |
