 |
 |
GEO help: Mouse over screen elements for information. |
|
Status |
Public on Apr 19, 2022 |
Title |
E1_FGO_4_Ribo |
Sample type |
SRA |
|
|
Source name |
Oocyte
|
Organism |
Mus musculus |
Characteristics |
genotype: WT developmental stage: Full-grown oocyte molecule: Ribosome protected fragment
|
Extracted molecule |
total RNA |
Extraction protocol |
To obtain oocytes or preimplantation embryos, 8-weeks-old or 5-weeks-old C57BL/6 female mice were intraperitoneally injected with pregnant mare’s serum gonadotropin (PMSG; 5 IU) and human chorionic gonadotrophin (hCG; 5 IU). Preimplantation embryos were collected from 5-weeks-old C57BL/9 female mice mated with PWK/PhJ male mice. Samples was lysed in 310 μl ice-cold lysis buffer (20 mM Tris-HCL ph7.4; 150 mM NaCl; 5 mM MgCl2; 1mM DTT; 100 μg/ml Cycloheximide; 1% Triton; 25 U/ml Turbo Dnase Turbo DNase (Ambion, AM2239)) for 10 min. The lysate was clarified for 10 min at 20,000g at 4°C, then treated with 1 μl RNase I 100 U/ml (Ambion, AM2295) and incubated at room temperature for 45 min with gentle mixing. For 107 mESC and HEK293 cells, 7 μl RNase I was added. The digested extracts were stopped by the addition of 10 μl SUPERas•In (Ambion, AM2696) and were overlaid onto a 700 μl sucrose cushion of 1M sucrose in 20mM total Tris-HCL pH7.4; 150 mM NaCl; 5 mM MgCl2; 1 mM DTT; 100 μg/ml Cycloheximide; 20 U/ml SUPERas•In (Ambion, AM2696) for 4 hr at 76,400 rpm in a MLA-150 rotor in a Beckman Optima MAX-XP ultracentrifuge. The supernatant was removed and the pellet was resuspended in 50 μl pellet buffer (10 mM Tris (pH 7.5); 1% SDS). RNA was extracted from pellet buffer using TRIzol (life tech, 15596018), chloroform and aqueous phase was precipitated by at least one volume of isopropanol and 20 μg glycogen. Precipitation was carried out at -20°C overnight and RNA was then pelleted by centrifugation for 40 min at 12,000g, 4°C. RNA was resuspended in 6 μl Nuclease-free water and mix with 6 μl Gel Loading Buffer II (ThermoFisher, AM8549G).
|
|
|
Library strategy |
OTHER |
Library source |
transcriptomic |
Library selection |
other |
Instrument model |
Illumina HiSeq 1500 |
|
|
Description |
E1_singlecell_all_fpkm.txt
|
Data processing |
Ribo-lite reads were trimmed with cutadapt v1.14 with parameters: cutadapt --trim-n -a GATCGGAAGAGCACACGTCTG -a AGAGCACACGTCTG <input.file> | cutadapt -u 3 -a A{100} --no-indels -e 0.16666666666666666 - | cutadapt -O 8 --match-read-wildcards -g GTTCAGAGTTCTACAGTCCGACGATCSSS -m 18 - -o <output.file> , and the trimmed reads were sequentially mapped to mouse/human rRNAs sequences (mm9/hg19) using Bowtie2 v2.2.2 with parameters --seedlen=23. Those aligned to rRNA were discarded, and the rest reads were mapped to transcriptome of mm9/hg19 using STAR v2.5.3a with parameters --outFilterMismatchNmax 2 --outFilterMultimapNmax 20 --outFilterMatchNmin 16 --alignEndsType EndToEnd. The gene expression level was then calculated by Cufflinks v2.2.1 based on the annotation of CDS region。 All mRNA-seq data were trimmed by Trim Galore v0.4.2 then mapped to transcriptome of mm9/hg19 by STAR v2.5.3a with parameters --outFilterMultimapNmax 20 --outSAMstrandField intronMotif. The gene expression level was calculated by Cufflinks v2.2.1. After sequencing, CCS reads were extracted. The CCS reads were further split into different samples based on barcode and trimmed into clean reads. (The uploaded data are splitted and trimmed already). The clean reads were aligned to the mm9 genome using minimap. The poly(A) tail length of each transcript was calculated by the length of the clipped sequence. The poly(A) tail length of a gene was presented by the genomic mean of the poly(A) tail length of all the transcript as described44. For MII poly(A) tail length analysis, we merged WT and Btg4+/- data as MII control poly(A) tail length data to increase data depth after confirming their similarity. Assembly: mm9 Library strategy: Ribo-lite
|
|
|
Submission date |
Apr 07, 2022 |
Last update date |
Apr 19, 2022 |
Contact name |
Zhuqing Xiong |
E-mail(s) |
lexizqxiong@gmail.com
|
Organization name |
School of Life Science, Tsinghua Univers
|
Street address |
Haidian District
|
City |
Beijing |
State/province |
FOREIGN |
ZIP/Postal code |
100084 |
Country |
China |
|
|
Platform ID |
GPL18480 |
Series (1) |
GSE165782 |
Ultrasensitive Ribo-seq reveals translational landscapes during mammalian oocyte-to-embryo transition and pre-implantation development |
|
Relations |
BioSample |
SAMN27404743 |
SRA |
SRX14778600 |
Supplementary data files not provided |
SRA Run Selector |
Processed data are available on Series record |
Raw data are available in SRA |
|
|
|
|
 |