NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Sample GSM5835483 Query DataSets for GSM5835483
Status Public on Jun 20, 2022
Title ChIP_H3K27ac_HH35_FB_rep1
Sample type SRA
 
Source name forebrain
Organism Gallus gallus
Characteristics developmental stage: HH35
strain: White Leghorn
genotype: WT
chip antibody: H3K27ac Diagenode #C15410196
Treatment protocol dissection: Four telencephalons from HH35 embryos were micro-dissected.
Extracted molecule genomic DNA
Extraction protocol ChIP-seq experiments were performed as described in (Rodríguez-Carballo et al 2017).
ChIP-seq libraries were prepared as described in (Rodríguez-Carballo et al 2017).
 
Library strategy ChIP-Seq
Library source genomic
Library selection ChIP
Instrument model Illumina HiSeq 4000
 
Description ChIP
Data processing All scripts are available on https://gitlab.unige.ch/Aurelie.Hintermann/hintermannetal2022
TruSeq adapters were removed from single-reads fastqs with cutadapt version 1.16 (Martin 2011 -a CTGTCTCTTATACACATCTCCGAGCCCACGAGAC -q 30 -m 15).
Filtered reads were mapped to the mouse genome mm10 with bowtie2 version 2.3.5 (Langmead et al. 2012 with default options). Only alignments with a mapping quality above 30 were kept (samtools version 1.9 Danecek et al. 2021).
Normalization was done by subsampling filtered reads with samtools view to the lowest number of reads among samples of one species, which is 42317564 for mouse and 22886295 for chicken.
Peak calling was run with a fixed fragment size of 200bp with macs2 callpeak version 2.1.1.20160309 (--call-summits --nomodel --extsize 200 -B).
Genome_build: mm10
Genome_build: galGal6
Supplementary_files_format_and_content: bigwig: normalized coverage track, when multiple biological replicates were done, the average was done
Supplementary_files_format_and_content: narrowPeak: narrowPeak from macs2
All scripts are available on https://gitlab.unige.ch/Aurelie.Hintermann/hintermannetal2022
TruSeq adapters were removed from single-reads fastqs with cutadapt version 1.16 (Martin 2011 -a CTGTCTCTTATACACATCTCCGAGCCCACGAGAC -q 30 -m 15).
Filtered reads were mapped to the mouse genome mm10 with bowtie2 version 2.3.5 (Langmead et al. 2012 with default options). Only alignments with a mapping quality above 30 were kept (samtools version 1.9 Danecek et al. 2021).
Normalization was done by subsampling filtered reads with samtools view to the lowest number of reads among samples of one species, which is 42317564 for mouse and 22886295 for chicken.
Peak calling was run with a fixed fragment size of 200bp with macs2 callpeak version 2.1.1.20160309 (--call-summits --nomodel --extsize 200 -B).
Open H3K27ac peaks were obtained by the intersection of H3K27ac peaks with ATAC peak regions in matching tissues, using betdtools intersect.
Conserved non-coding open H3K27ac peaks were obtained by the intersection of open H3K27ac peaks with conserved non-coding elements using betdtools intersect.
processed data files format and content: "OL_ATAC" narrowPeak: open H3K27ac peaks
processed data files format and content: "OL_ATAC_OL_CNEs" narrowPeak: conserved, non-coding and open H3K27ac peaks
 
Submission date Jan 25, 2022
Last update date Jun 20, 2022
Contact name Aurelie Hintermann
E-mail(s) aur.hin@gmail.com
Organization name University of Geneva
Department Genetics and Evolution
Street address 30 quai Ernest-Ansermet
City Geneva
ZIP/Postal code 1205
Country Switzerland
 
Platform ID GPL23499
Series (2)
GSE194418 Developmental and evolutionary comparative analysis of a HoxD regulatory landscape in mammals and birds [ChIP-seq]
GSE195592 Developmental and evolutionary comparative analysis of a HoxD regulatory landscape in mammals and birds
Relations
BioSample SAMN25248164
SRA SRX13912603

Supplementary file Size Download File type/resource
GSM5835483_ChIP_H3K27ac_HH35_FB_rep1.bigwig 211.5 Mb (ftp)(http) BIGWIG
GSM5835483_ChIP_H3K27ac_HH35_FB_rep1.narrowPeak.gz 184.2 Kb (ftp)(http) NARROWPEAK
GSM5835483_ChIP_H3K27ac_HH35_FB_rep1_OL_ATAC_HH35_FB.narrowPeak.gz 166.1 Kb (ftp)(http) NARROWPEAK
GSM5835483_ChIP_H3K27ac_HH35_FB_rep1_OL_ATAC_HH35_FB_OL_CNEs.bed.gz 74 b (ftp)(http) BED
SRA Run SelectorHelp
Raw data are available in SRA
Processed data provided as supplementary file
Processed data are available on Series record

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap