 |
 |
GEO help: Mouse over screen elements for information. |
|
Status |
Public on Jan 27, 2023 |
Title |
Lung_A_12 |
Sample type |
SRA |
|
|
Source name |
Rapid biopsy post-morterm lung tissue Donor CUN5/A
|
Organism |
Homo sapiens |
Characteristics |
molecule: Oligonucleotide individual: donor CUN5/A tissue: post-morterm lung disease state: COVID-19 morphology: Geometric; Alveolar morphology severity: Severe sample name: CUN5_3_012 sample name_2: DSP-1012340036901-C05 title_2: CUN5_3_ROI_012_well_C05 slide id: CUN5_3 roi number: 012 segment type: Segment1 area: 313313 nuclei_counts: 1561 roi x coordinate: 16329 roi y coordinate: 18524 rawreads: 7306258 alignedreads: 6715975 deduplicatedreads: 1053425 trimmedreads: 7277122.0 stitchedreads: 7188481.0 sequencingsaturation: 85.6 severity binary: Severe proximal sars-cov-2 nucleocapsid protein: No
|
Extracted molecule |
other |
Extraction protocol |
Samples were incubated with DNA-oligo barcoded RNA-ISH probes which were conjugated with a UV-photocleavable linker following standard ISH protocols, along with fluorescently labeled antibodies for visualization of morphological structures. Regions of interest within the tissue were illuminated with UV light and oligo barcodes were physically aspirated from the tissue and collected into microtiter plates by the GeoMx® Digital Spatial Profiler (DSP) platform. For more information about DSP protocols please see Merritt et al. Nature Biotech 2020 (doi: 10.1038/s41598-020-63539-x) Each collection of oligo tags from one well (representing an ROI from the tissue section) was indexed with i7xi5 unique dual indexes using GeoMx SeqCode primers with 18 cycles of PCR. After PCR, indexed AOIs were pooled and purified in two rounds of AMPure XP PCR purification using 1.2x bead:sample ratio. Samples were pooled during library preparation and split across lanes. Individual FASTQ files were generated for each lane, forward & reverse primers. The Fastq files contain the same identifier as the sample name for aggregation.
|
|
|
Library strategy |
OTHER |
Library source |
genomic |
Library selection |
other |
Instrument model |
NextSeq 2000 |
|
|
Data processing |
Library strategy: GeoMx Seq save-interim-files = false quality-trim-score = 20 2color-trimming = True adapter1 = AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC adapter2 = AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT adapter-trim-match-length = 10 adapter-trim-max-mismatch = 3 barcode-max-mismatch = 1 stitching-max-mismatch = 2 dedup-hd = 1 threads = 4 Quality control and initial data exploration was conducted using the GeoMx DSP Analysis Suite. Sequencing quality per AOI was examined and an under-sequenced area (B_04) with zero deduplicated reads was excluded. Expression of each transcript was measured by 5 or more probes; outlier probes (geomean probe in all AOI/geomean of all probes for a transcript = <0.1; or probe failure in the Grubbs outlier test in over 20% AOIs) were excluded and the remaining probes combined to generate a single (post “biological probe QC”) expression value per gene target per AOI. Genome_build: N/A, sequencing of synthetic tags and alignment to whitelist of RTS_IDs (probe barcodes) found in the config.ini output from the GeoMx DSP platform, see attached PKC files (Alpha_CTA_v2.0.pkc, and GeoMx_COVID19_v1.0.pkc) Supplementary_files_format_and_content: Digital Count Conversion (DCC) file format outputted from GeoMx NGS Pipeline, contains software versions, scan attributes, GeoMx NGS pipeline parameters and output metrics, Q30 scores, and list of deduplicated counts per RTS_ID (probe barcode). Png files show the immunofluorescent microscopy image corresponding to each sample, including a white line border around the acquired areas of interest (AOIs). The multichannel rendered images show DNA in blue, CD45 in red, PanCK in green and CD68 in yellow. Supplementary_files_format_and_content: [value definition] Values represented in the 'TargetCountMatrix' sheet of the ‘Post Biological Probe QC.xlsx’ are the geometric mean of the probes for a given target--in the case that multiple probes were used-- and excludes any targets flagged as outliers. A single sample (Cun4_2_004) was removed for sequencing failure and the absence of detected RawReads and AlignedReads. Analyzed counts in 'qn.exprs.tsv' represent quantile normalized collapsed counts for each sample in the study. Analyzed counts in 'qn.exprs.corrected.tsv' represent quantile normalized collapsed counts for each sample in the study and corrected for batch effects using the Limma "removeBatchEffect" function.
|
|
|
Submission date |
Oct 20, 2021 |
Last update date |
Jan 29, 2023 |
Contact name |
Amy Rachael Cross |
E-mail(s) |
amy.cross@nds.ox.ac.uk
|
Organization name |
University of Oxford
|
Department |
NDS
|
Lab |
TRIG
|
Street address |
John Radcliffe Hospital
|
City |
Oxford |
ZIP/Postal code |
OX38DU |
Country |
United Kingdom |
|
|
Platform ID |
GPL30173 |
Series (1) |
GSE186213 |
Spatial transcriptomic characterization of the lung parenchyma during COVID-19 pneumonitis |
|
Relations |
BioSample |
SAMN22425889 |
SRA |
SRX12700596 |
Supplementary file |
Size |
Download |
File type/resource |
GSM5640757_CUN5_A_ROI_012_merge_Segment_2.png.gz |
4.9 Mb |
(ftp)(http) |
PNG |
GSM5640757_DSP-1012340036901-C05.dcc.gz |
32.1 Kb |
(ftp)(http) |
DCC |
SRA Run Selector |
Raw data are available in SRA |
Processed data provided as supplementary file |
Processed data are available on Series record |
|
|
|
|
 |