|
Status |
Public on Apr 26, 2023 |
Title |
Fkh1_R1_test |
Sample type |
SRA |
|
|
Source name |
bound fragments from in vitro library
|
Organism |
synthetic construct |
Characteristics |
round: 1 protein: Fkh1
|
Extracted molecule |
genomic DNA |
Extraction protocol |
The protein of interest was incubated with the randomized library and run on a non-denaturing polyacrylamide gel at 4 ⁰C. Bound fragments were excised and purified using phenol:chloroform:isoamyl extraction. An aliquot was then used for an additional round of selection and extraction. Illumina adapters and barcodes and were then added to the selected libraries usng 4 cycle PCR, and samples were sent for sequencing. A hand-mixed library containing a 16 bp randomized region was ordered from IDT with standard desalting. The library was made double stranded using the Klenow reaction.
|
|
|
Library strategy |
OTHER |
Library source |
genomic |
Library selection |
other |
Instrument model |
Illumina HiSeq 2500 |
|
|
Description |
processed data file: Fkh1_test_core_ddG.tsv Fkh1_test_edge_ddG.tsv
|
Data processing |
library strategy: SELEX-seq Fixed adapters are trimmed using cutadapt v2.10, leaving only bases of the 16 bp variable region (Test Samples: cutadapt -g ^CGC -a CCTGGAATTCTCGGGTGCCAAGGAACTCCAG$ -O 10 -n 2 --discard-untrimmed --max-n 0 -m 16 -M 16; Production Samples: cutadapt -g ^CAG -a TCCGTATCGCTCCTCCAATG$ -O 10 -n 2 --discard-untrimmed --max-n 0 -m 16 -M 16) Unexpected runs of cytidine were present in the Fhl1 samples, reads with runs of at least 7 cytidines were removed The relative enrichment of various length k-mers are calculated using the same process as the SELEX package on bioconductor, the square root of the enrichment is provided for R2 samples Supplementary files format and content: tsv files that can be easily viewed in excel or a text editor of your choice folders of tsv files are archived and compressed into tar.gz format
|
|
|
Submission date |
Jun 24, 2021 |
Last update date |
Apr 26, 2023 |
Contact name |
Remo Rohs |
Organization name |
University of Southern California
|
Department |
Quantitative and Computational Biology
|
Lab |
Rohs Lab
|
Street address |
1050 Childs Way
|
City |
Los Angeles |
State/province |
CA |
ZIP/Postal code |
90089 |
Country |
USA |
|
|
Platform ID |
GPL19604 |
Series (1) |
GSE178811 |
DNA Binding Specificities of Fkh1, Fkh2, Hcm1, and Fhl1 Revealed by SELEX-seq |
|
Relations |
BioSample |
SAMN19855068 |
SRA |
SRX11218617 |