|
| Status |
Public on Sep 06, 2022 |
| Title |
PBAT wildtype blastocyst |
| Sample type |
SRA |
| |
|
| Source name |
blastocyst
|
| Organism |
Mus musculus |
| Characteristics |
strain: C57BL/6 (maternal), JF1 (paternal)
Stage: blastocyst
genotype: wildtype
|
| Treatment protocol |
Superovulated C57BL/6 MII oocytes were in vitro fertilized by JF1 inseminated sperm. Fertilized zygotes were culture in KSOM medium. Mature blastocysts were collected at 96 hours post fertilization.
|
| Growth protocol |
All animal experiments were performed under the ethical guidelines of Kyushu University. All mice used in this manuscript were aged 4 weeks or older and were euthanized by CO2 asphyxiation.
|
| Extracted molecule |
genomic DNA |
| Extraction protocol |
Cells were lyzed by proteinase K and 2% SDS. Cell extract was directly applied to library construction.
Libraries were constructed using the post-bisulfite adapter tagging method (Miura et al., 2012; Au Yeung et al., 2019). Pooled blastocysts were spiked with 1% unmethylated lambda phage DNA (Promega). Libraries were amplified with KAPA library amplification kit (KAPA) for 4 cycles using primers AATGATACGGCGACCACCGAGATCTACAC and CAAGCAGAAGACGGCATACGAGAT. Libraries were sequenced on HiSeq 1500 and NovaSeq 6000 (Illumina) (HiSeq: HCS v2.2.68 and RTA v1.18.66.3; NovaSeq: NVCS v1.6.0 and RTA v3.4.4) using TruSeq SBS kit v3-HS and NovaSeq S1 reagent kit v1 (Illumina) according to manufacturer’s protocols
|
| |
|
| Library strategy |
Bisulfite-Seq |
| Library source |
genomic |
| Library selection |
RANDOM |
| Instrument model |
Illumina HiSeq 1500 |
| |
|
| Data processing |
Low quality bases in the 3’ portion (Q <30) and adapter sequences were removed from raw reads by Trim-Galore! v0.3.3 and trimmed reads were mapped to mouse genome mm10 by Bismark v0.20.0 with options ‘--bowtie2 --pbat -D 75’. For allelic-specific analysis, trimmed reads were mapped to N-masked mm10 genome using published SNP data of JF1 strain. Allelic reads were selected using SNPsplit v0.3.2.
Genome_build: mm10/GRCm38
Supplementary_files_format_and_content: The CpG coverage files of maternal/paternal genome are space-delimited, 1-based genomic coordinates for every covered CpG dinucleotide in the experiment and are in the following format: <chromosome> <CpG position> <number of methylated cytosines> <number of unmethylated cytosines> <methylation level (0to1)>.
|
| |
|
| Submission date |
May 12, 2021 |
| Last update date |
Sep 06, 2022 |
| Contact name |
Wan Kin Au Yeung |
| E-mail(s) |
donald.aywk@outlook.com
|
| Organization name |
Kyushu University
|
| Department |
Department of Molecular and Structural Biology
|
| Lab |
Division of Epigenomics and Development
|
| Street address |
3-1-1 Maidashi, Higashi-ku
|
| City |
Fukuoka |
| ZIP/Postal code |
812-8582 |
| Country |
Japan |
| |
|
| Platform ID |
GPL18480 |
| Series (1) |
| GSE174311 |
Whole-genome bisulfite sequencing anlaysis of in vitro fertilized mouse hybrid blastocysts |
|
| Relations |
| BioSample |
SAMN19115489 |
| SRA |
SRX10854666 |
