|
Status |
Public on Dec 17, 2020 |
Title |
DND41_PTEN_enhancer_rep1 |
Sample type |
SRA |
|
|
Source name |
DND41
|
Organism |
Homo sapiens |
Characteristics |
cell type: leukemic cell line bait: PTEN_enhancer cell line: DND41
|
Treatment protocol |
All samples were collected under same treatment conditions as described in growth protocol
|
Growth protocol |
We performed cell culture of cell lines in standard conditions in a humidified atmosphere at 37°C under 5% CO2. DND41 (ACC 525), JURKAT (ACC 282), HPB-ALL (ACC 483) cells were obtained from Deutsche Sammlung von Mikroorganismen und Zellkulturen (DSMZ). T-ALL cells were cultured in HyClone RPMI 1640 Media (SH3002701, Fisher Scientific) supplemented with 10% FBS (900-108, Gemini Bio-Products) and 1% penicillin-streptomycin (45000-652, VWR).
|
Extracted molecule |
genomic DNA |
Extraction protocol |
4C-Seq was prepared using HindIII and DpnII digestions. The following primers were used for amplification (human PTEN promoter viewpoint: FW-AAATATCAACACTGAAGCTT and RV- GCCTCCAGTTGATTTCCAGA; human PE viewpoint FW- CAGCTTCTCCTTTTAAGCTT and RV- CACAGACATAATGCTGGGAA; mouse Pten promoter viewpoint FW- GTTCATCCTGAGTAAAGCTT and RV- CAAAAGATAATTGGTGAGCA; mouse PE viewpoint: FW- CCTCTATATGAGAGAAGCTT and RV- AAGAGCTGGCCACATGGTGA)
|
|
|
Library strategy |
OTHER |
Library source |
genomic |
Library selection |
other |
Instrument model |
Illumina HiSeq 2500 |
|
|
Data processing |
Library strategy: 4C-Seq The first nucleotides in each read (corresponding to barcode) and the nucleotides corresponding to theHindIII primer were trimmed from the 5' of the read Mapping was performed using Bowtie2 to a reduced genome consisting of all unique 24 nucleotide-long regions surrounding DpnII sites allowing for zero mismatches. Analysis of 4C-Seq signal was performed by building successive 25kb windows with 90% overlap and calculating the total number of reads per window. Genome_build: mm10 and hg19 Supplementary_files_format_and_content: bedgraph files show total read count per 25kb window. Windows show 90% overlap.
|
|
|
Submission date |
Oct 29, 2020 |
Last update date |
Dec 17, 2020 |
Contact name |
Pedro P Rocha |
E-mail(s) |
pedrorocha@nih.gov
|
Phone |
3014022426
|
Organization name |
National Institutes of Health
|
Department |
NICHD
|
Lab |
Unit on Genome Structure and Regulation
|
Street address |
6 Center Drive Building 6B 2B220
|
City |
Bethesda |
State/province |
Maryland |
ZIP/Postal code |
20892-2785 |
Country |
USA |
|
|
Platform ID |
GPL16791 |
Series (1) |
GSE160427 |
A Tumor Suppressor Enhancer of PTEN in T-cell development and leukemia |
|
Relations |
BioSample |
SAMN16595624 |
SRA |
SRX9400254 |