NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Sample GSM4777737 Query DataSets for GSM4777737
Status Public on Sep 16, 2021
Title DEEP_br1_bcl6
Sample type SRA
 
Source name Skeletal muscle
Organism Mus musculus
Characteristics strain: C57BL/6
cell type: Freshly isoalted muscle stem cell
age: post natal day 38
genotype: Pax7Cas9
Extracted molecule genomic DNA
Extraction protocol Genomic DNA was extracted by QuickExtract (Epicentre) solution.
Genomic DNAs from AAV9-sgRNA infected satellite cells were amplified using Q5 High-Fidelity 2× Master Mix (NEB). PCR products were purified through QIAQuick PCR purification kit (Qiagen) and subjected to library preparation using NEBNext® Ultra™ II DNA Library Preparation Kit (NEB).
 
Library strategy OTHER
Library source genomic
Library selection other
Instrument model Illumina HiSeq 1500
 
Description Bcl6_deep seq_rep1
Data processing Library strategy: Deep-seq
Illumina Casava1.8 software used for basecalling.
Sequenced reads were trimmed for adaptor sequence using trimmomatic v0.36 with parameter SLIDINGWINDOW:4:15 MINLEN:50, and reads without primer(Fwd:5'-AGTTAAGACGACTCTCACGG-3' and Rev:AGGCCTCATTCACTTTGCTC) are removed,then mapped to mm9 and conduct editting pattern using CRISPResso2 with parameter -w 20 --max_paired_end_reads_overlap 150 --amplicon_min_alignment_score 40 --min_identity_score 40
Genome_build: mm9
Supplementary_files_format_and_content: folder(with all CRISPResso2 output files inside)
 
Submission date Sep 13, 2020
Last update date Sep 16, 2021
Contact name Yingzhe Ding
E-mail(s) 1155068845@link.cuhk.edu.hk
Organization name The Chinese University of Hong Kong
Department Chemical Pathology
Street address Rm503,Li Ka Shing Medical Science Build.,Prince of Wales Hosp.,30-32 Ngan SHing St.
City Hong Kong
State/province Shatin NT.
ZIP/Postal code 999077
Country Hong Kong
 
Platform ID GPL18480
Series (2)
GSE134529 CRISPR/Cas9/AAV9-sgRNA Mediated In Vivo Genome Editing Reveals the Indispensability of Myc During Muscle Stem Cells Activation by Remodeling the 3D Chromatin
GSE157871 CRISPR/Cas9/AAV9-sgRNA Mediated In Vivo Genome Editing Reveals the Indispensability of Myc During Muscle Stem Cells Activation by Remodeling the 3D Chromatin [DEEP-seq(MyoD&Myc&Bcl6&Pknox2)]
Relations
BioSample SAMN16121587
SRA SRX9112764

Supplementary file Size Download File type/resource
GSM4777737_DEEP_Bcl6_rep1.tar.gz 2.1 Mb (ftp)(http) TAR
SRA Run SelectorHelp
Raw data are available in SRA
Processed data provided as supplementary file

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap