|
Status |
Public on Sep 16, 2021 |
Title |
DEEP_br1_bcl6 |
Sample type |
SRA |
|
|
Source name |
Skeletal muscle
|
Organism |
Mus musculus |
Characteristics |
strain: C57BL/6 cell type: Freshly isoalted muscle stem cell age: post natal day 38 genotype: Pax7Cas9
|
Extracted molecule |
genomic DNA |
Extraction protocol |
Genomic DNA was extracted by QuickExtract (Epicentre) solution. Genomic DNAs from AAV9-sgRNA infected satellite cells were amplified using Q5 High-Fidelity 2× Master Mix (NEB). PCR products were purified through QIAQuick PCR purification kit (Qiagen) and subjected to library preparation using NEBNext® Ultra™ II DNA Library Preparation Kit (NEB).
|
|
|
Library strategy |
OTHER |
Library source |
genomic |
Library selection |
other |
Instrument model |
Illumina HiSeq 1500 |
|
|
Description |
Bcl6_deep seq_rep1
|
Data processing |
Library strategy: Deep-seq Illumina Casava1.8 software used for basecalling. Sequenced reads were trimmed for adaptor sequence using trimmomatic v0.36 with parameter SLIDINGWINDOW:4:15 MINLEN:50, and reads without primer(Fwd:5'-AGTTAAGACGACTCTCACGG-3' and Rev:AGGCCTCATTCACTTTGCTC) are removed,then mapped to mm9 and conduct editting pattern using CRISPResso2 with parameter -w 20 --max_paired_end_reads_overlap 150 --amplicon_min_alignment_score 40 --min_identity_score 40 Genome_build: mm9 Supplementary_files_format_and_content: folder(with all CRISPResso2 output files inside)
|
|
|
Submission date |
Sep 13, 2020 |
Last update date |
Sep 16, 2021 |
Contact name |
Yingzhe Ding |
E-mail(s) |
1155068845@link.cuhk.edu.hk
|
Organization name |
The Chinese University of Hong Kong
|
Department |
Chemical Pathology
|
Street address |
Rm503,Li Ka Shing Medical Science Build.,Prince of Wales Hosp.,30-32 Ngan SHing St.
|
City |
Hong Kong |
State/province |
Shatin NT. |
ZIP/Postal code |
999077 |
Country |
Hong Kong |
|
|
Platform ID |
GPL18480 |
Series (2) |
GSE134529 |
CRISPR/Cas9/AAV9-sgRNA Mediated In Vivo Genome Editing Reveals the Indispensability of Myc During Muscle Stem Cells Activation by Remodeling the 3D Chromatin |
GSE157871 |
CRISPR/Cas9/AAV9-sgRNA Mediated In Vivo Genome Editing Reveals the Indispensability of Myc During Muscle Stem Cells Activation by Remodeling the 3D Chromatin [DEEP-seq(MyoD&Myc&Bcl6&Pknox2)] |
|
Relations |
BioSample |
SAMN16121587 |
SRA |
SRX9112764 |