 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Feb 15, 2021 |
| Title |
Ctrl of GATA2/3 KO, clone_BTAG; day2, MS168Y19 |
| Sample type |
SRA |
| |
|
| Source name |
day2, from 585B1 hiPSC BTAG reporter line
|
| Organism |
Homo sapiens |
| Characteristics |
cell line: 585B1 hiPSCs
sampled time point: day2
reporter transgene: Blimp1-tdTomato, TFAP2C-EGFP
other transgenes: none
treatment: BMP
pgclcs induced: Yes
|
| Treatment protocol |
The iMeLC induction was induced from iPSC cultured in above condition, passaged to fibronectin coated plate with Activin A (50 ng/ml), CHIR99021 (3µM) and Y27632 (10µM) in GMEM containing 15% KSR, and cultured for 44 to 48 hours.
Above iMeLCs were then dissociated and replated to low-adherent V-bottom plates to form aggregates with SCF (100 ng/ml), EGF (50 ng/ml), LIF(1000U/ml), Y27632 (10µM) and BMP4 (200 ng/mL) or Dox (1.0 µg/mL) in GMEM containing 15% KSR, until the harvest day.
For day 77 samples, BTAG positive cells were aggregated with mouse female E12.5 gonadal somatic cells and maintained at air-liquid interphase culture in MEMalpha with 10% FBS.
|
| Growth protocol |
585B1 hiPSCs (XY) was cultured with AK03N medium on iMatrix coated plate as reported previously (Sasaki and Yokobayashi et al., 2015; Kojima et al., 2017).
|
| Extracted molecule |
total RNA |
| Extraction protocol |
The cells were pelleted down and snap frozen until use. RNA samples were extracted with RNeasy kit following manufacturer's protocol.
For 3'-seq analysis, cDNA synthesis / amplification from RNA samples and library construction from the cDNAs were performed as described previously [Nakamura et al. 2015, NAR, 43, e60].
|
| |
|
| Library strategy |
RNA-Seq |
| Library source |
transcriptomic |
| Library selection |
cDNA |
| Instrument model |
Illumina NextSeq 500 |
| |
|
| Description |
Transcriptome of amplified cDNA from PGCLC induction of Ctrl of GATA2/3 KO series, clone BTAG, harvested at day2, BTAG-sorted
|
| Data processing |
All the reads were surveyed and the adaptor or the poly-A sequences were trimmed by cutadapt-1.3 with options "-e 0.1 -q 20 -n 2 -O 1 -m 30 -a CTCGAGGGCGCGCCGGATCC -g CTCGAGGGCGCGCCGGATCC -a AAAAAAAAAAAAAAAAAAAA -a TTTTTTTTTTTTTTTTTTTT". The trimmed reads with less than 30 bp were discarded.
Untrimmed and trimmed reads of 30 bp or longer were mapped onto the human genomeGRCh38.p2 and the ERCC spike-in RNA sequences with tophat-1.4.1/bowtie1.0.1 with the “—no-coverage-search” option.
Mapped reads on the genome and the ERCC were separated, and the reads on the genome were converted into the expression levels (RPM) by cufflinks-2.2.0 using the “—compatible-hits-norm”, “—max-mle-iterations 50000", “—no-length-correction” and “—library-type fr-secondstrand” options and GRC38.p2 reference gene annotations with extended TTSs. For the reference gene annotations used in cufflinks, we extended the TTSs of the reference genes up to 10 kb downstream to correctly estimate the expression levels of genes whose transcripts are longer than the reference toward the 3 prime.
Expression levels (read counts per gene) were also estimated with HTSeq v0.9.1.
Genome_build: GRCh38.p2
Supplementary_files_format_and_content: tab-delimited text files include RPM values for each Sample
Supplementary_files_format_and_content: tab-delimited text files include gene name, entrez_id and read count for each Sample
|
| |
|
| Submission date |
Jul 19, 2020 |
| Last update date |
Feb 17, 2021 |
| Contact name |
Yukihiro Yabuta |
| E-mail(s) |
yabyab@anat2.med.kyoto-u.ac.jp
|
| Organization name |
Kyoto University, Graduate school of medicine
|
| Department |
Anatomy and Cell Biology
|
| Street address |
Yoshida-Konoe-cho, Sakyo-ku
|
| City |
Kyoto |
| State/province |
Kyoto |
| ZIP/Postal code |
606-8501 |
| Country |
Japan |
| |
|
| Platform ID |
GPL18573 |
| Series (2) |
| GSE154688 |
GATA transcription factors, SOX17 and TFAP2C, drive the human germ-cell specification program [RNA-Seq] |
| GSE154691 |
GATA transcription factors, SOX17 and TFAP2C, drive the human germ-cell specification program |
|
| Relations |
| BioSample |
SAMN15579426 |
| SRA |
SRX8770234 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM4677314_rnaseq_MS168Y019_RPM.txt.gz |
176.9 Kb |
(ftp)(http) |
TXT |
| GSM4677314_rnaseq_MS168Y019_htseq_count.txt.gz |
280.0 Kb |
(ftp)(http) |
TXT |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data provided as supplementary file |
|
|
|
|
 |
