NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Sample GSM4564097 Query DataSets for GSM4564097
Status Public on Aug 30, 2021
Title 80C313Y_WT
Sample type SRA
 
Source name 80C313Y_WT
Organism Mus musculus
Characteristics strain: NOD
tissue: mTEChi
age: 4-7 weeks
genotype: Aire +/+
Extracted molecule total RNA
Extraction protocol Thymi were removed and enzymatically dissociated with Liberase TH and DNase. mTEChi were sorted and RNA was extracted using Dynabeads. MARSseq protocol was used construction of sequencing libraries.
RNA libraries were prepared for sequencing using the MARSseq protocol (Jaitin et. Al. 2014)
Bulk Mars-Seq (3' end-RNA-seq)
 
Library strategy RNA-Seq
Library source transcriptomic
Library selection cDNA
Instrument model Illumina NextSeq 500
 
Description Deseq_all_results_C313Y_AireKO_NOD.txt
Data processing Data was processed using UTAP pipeline (Kohen et al., 2019). Bcl files were converted into fastq by bcl2fastq. Demultiplexing is done using the sample barcode found on R2, the UMI found on R2 is inserted in the read name (in R1 fastq). R1 Fastq data submitted.
Reads were trimmed using Cutadapt (parameters: -a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -a “A{10}” –times 2 -u 3 -u -3 -q 20 -m 25) and mapped to the Mus_musculus genome using STAR v2.4.2a (parameters: –alignEndsType EndToEnd, –outFilterMismatchNoverLmax 0.05, –twopassMode Basic, –alignSoftClipAtReferenceEnds No).
The pipeline quantifies the 3’ of Gencode annotated genes (The 3’ region contains 1,000 bases upstream of the 3’ end and 100 bases downstream). Counting proceeded over genes annotated in RefSeq release using htseq-count (union mode). Genes having minimum 5 UMI-corrected reads in at least one sample, were considered. Normalization of the counts and differential expression analysis was performed using DESeq2 package.
Differential expression analysis was performed using DESeq2 with the betaPrior set to False. Raw P values were adjusted for multiple testing using the procedure of Benjamini and Hochberg. Differentially expressed genes were defined as genes that had a significant adjusted p value of less than 0.05 and at least 2-fold change.
Genome_build: mm10
Supplementary_files_format_and_content: Raw counts, normalized abundance measurements and DESeq2 analysis
 
Submission date May 21, 2020
Last update date Aug 30, 2021
Contact name Jakub Abramson
E-mail(s) jakub.abramson@weizmann.ac.il
Organization name Weizmann Institute of Science
Department Department of Immunology
Street address 234 Herzl st.
City Rehovot
ZIP/Postal code 7610001
Country Israel
 
Platform ID GPL19057
Series (2)
GSE151012 Mechanistic dissection of dominant AIRE mutations in mouse models reveals evidence for AIRE auto-regulation [RNA-seq]
GSE151013 Mechanistic dissection of dominant AIRE mutations in mouse models reveals evidence for AIRE auto-regulation
Relations
BioSample SAMN14994119
SRA SRX8377904

Supplementary data files not provided
SRA Run SelectorHelp
Raw data are available in SRA
Processed data are available on Series record

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap