|
| Status |
Public on Dec 28, 2019 |
| Title |
Ago.CLIP_BAT_9t |
| Sample type |
SRA |
| |
|
| Source name |
interscapular brown adipose tissue
|
| Organism |
Mus musculus |
| Characteristics |
strain: C57BL/6J
tissue: interscapular brown adipose tissue
pooling: 2 mice per replicate
age: 15 week
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Tissues were UV-irradiated and subjected to Ago-CLIP with mouse anti-Ago (citation), clone INSERT (detailed desription in accompanying paper).
partial RNAse digestion, RNA linker ligation and PCR amplificiation. Ago-bound fragments were ligated to a degenerate 3'linker.
|
| |
|
| Library strategy |
OTHER |
| Library source |
transcriptomic |
| Library selection |
other |
| Instrument model |
Illumina MiSeq |
| |
|
| Data processing |
Library strategy: CLIP-seq
collapsing of exact sequences
stripping of degenerate linker (5nt; ends with a G)
removal of 3'adaptor (GTGTCAGTCACTTCCAGCGG)
alignment with novoalign (unambiguous mapping on mm10)
collapsing of PCR duplicates (unique CLIP tags)
clustering of unique reads
Genome_build: Genome_build: mm10
Supplementary_files_format_and_content: bedgraph files generated from Ago-CLIP unique tags for genome browser
|
| |
|
| Submission date |
Dec 27, 2019 |
| Last update date |
Dec 30, 2019 |
| Contact name |
Sean O'Connor |
| E-mail(s) |
soconnor@rockefeller.edu
|
| Organization name |
Rockefeller University
|
| Department |
Laboratory of Molecular Metabolism
|
| Lab |
Paul Cohen
|
| Street address |
1230 York Ave
|
| City |
New York |
| State/province |
NY |
| ZIP/Postal code |
10065 |
| Country |
USA |
| |
|
| Platform ID |
GPL16417 |
| Series (1) |
| GSE142677 |
AGO HITS-CLIP Reveals Distinct Patterns of miRNA Regulation of Visceral and Brown Adipose Tissue Identity |
|
| Relations |
| BioSample |
SAMN13691129 |
| SRA |
SRX7450757 |
