|
Status |
Public on Dec 28, 2019 |
Title |
Ago.CLIP_WAT_1t |
Sample type |
SRA |
|
|
Source name |
epididymal white adipose tissue
|
Organism |
Mus musculus |
Characteristics |
strain: C57BL/6J tissue: epididymal white adipose tissue pooling: 2 mice per replicate age: 15 week
|
Extracted molecule |
total RNA |
Extraction protocol |
Tissues were UV-irradiated and subjected to Ago-CLIP with mouse anti-Ago (citation), clone INSERT (detailed desription in accompanying paper). partial RNAse digestion, RNA linker ligation and PCR amplificiation. Ago-bound fragments were ligated to a degenerate 3'linker.
|
|
|
Library strategy |
OTHER |
Library source |
transcriptomic |
Library selection |
other |
Instrument model |
Illumina MiSeq |
|
|
Data processing |
Library strategy: CLIP-seq collapsing of exact sequences stripping of degenerate linker (5nt; ends with a G) removal of 3'adaptor (GTGTCAGTCACTTCCAGCGG) alignment with novoalign (unambiguous mapping on mm10) collapsing of PCR duplicates (unique CLIP tags) clustering of unique reads Genome_build: Genome_build: mm10 Supplementary_files_format_and_content: bedgraph files generated from Ago-CLIP unique tags for genome browser
|
|
|
Submission date |
Dec 27, 2019 |
Last update date |
Dec 30, 2019 |
Contact name |
Sean O'Connor |
E-mail(s) |
soconnor@rockefeller.edu
|
Organization name |
Rockefeller University
|
Department |
Laboratory of Molecular Metabolism
|
Lab |
Paul Cohen
|
Street address |
1230 York Ave
|
City |
New York |
State/province |
NY |
ZIP/Postal code |
10065 |
Country |
USA |
|
|
Platform ID |
GPL16417 |
Series (1) |
GSE142677 |
AGO HITS-CLIP Reveals Distinct Patterns of miRNA Regulation of Visceral and Brown Adipose Tissue Identity |
|
Relations |
BioSample |
SAMN13691136 |
SRA |
SRX7450750 |