 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Nov 08, 2019 |
| Title |
Mouse Liver M4 -AlkB ARM-seq |
| Sample type |
SRA |
| |
|
| Source name |
C57BL/6J male mouse Liver
|
| Organism |
Mus musculus |
| Characteristics |
tissue: Whole Liver
strain: C57BL/6J
Sex: male
|
| Treatment protocol |
All samples were collected from said mice at 2-3 PM EST. All tissue samples were then flash-frozen in liquid nitrogen and stored in -80˚C freezer until use.
|
| Growth protocol |
Samples were obtained from 3 C57BL/6J male 6-8 weeks old timepoints. Mice are housed in facilities with roughly 12 hr light-dark cycles (7AM-7PM light and 7PM-7AM dark)
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Isolation of total RNA from mouse Liver tissue was performed using Direct-Zol RNA MiniPrep Kit (Zymo Research) with TRI Reagent (Molecular Research Center, Inc.), typically yielding 400–450 μg of total RNA. Appropriate amounts of TRI Reagents was added to each tissue sample, along with ~400 uL of zirconium silicate beads (1.0 mm), and samples were homoginized using a tissue homoginization centrifuge. Sample size (n = 3) was selected to demonstrate the utility of the protocol at a level of replication achievable by most researchers. 50 μg of control or AlkB-treated RNA were processed using the MirVana miRNA Isolation Kit (Life Technologies), according to the manufacturer's instructions, to select for RNA <200 nt. RNA was concentrated to using a RNA Clean and Concentrate-25 (Zymo Research), after an on-column DNase I treatment to remove residual DNA. (New England BioLabs). Small RNA samples were divided and treated as minus AlkB control treatment and plus-AlkB experimental treatment. AlkB treatment was performed as previously described (Cozen et al. Nat Methods. 2015). Finally, RNA was concentrated after each enzymatic treatment using an RNA clean and concentration-5 kit (Zymo Research). Treated RNA was used for library preparation. Total RNA samples were obtained from HCC (control and experimental) mouse liver samples from the Kay lab (Stanford). Roughly 25-30 ug of total RNA was supplied from a TRIzol RNA isolation. These samples were then treated as above (starting from MirVana step) to obtain - and + AlkB-treated RNAs for ARM-seq library preparation. All RNA supplied was put through extraction protocol. (Note: DNase I step was ommitted in preparation of these samples)
For ARM-seq, libraries were constructed as previously described (Hrabeta-Robinson, et al. Methods Mol Biol. 2017) which utilizes the NEBNext Multiplex Small RNA Library Prep Set (NEB). PCR-amplified libraries were purified using DNA Clean and Concentrate-5 (Zymo Research) and then size-selected (140-250 nts) on a 6% non-denaturing TBE-acrylamide gel. Libraries were eluted from gel pieces using Gel Elution Buffer (NEB) and precipitated using .3 M NaOAc, 80% Ethanol, and 1 uL of Linear Acrylamide (supplied in NEBNext Kit) at final concentration. Samples were left in -80C freezer overnight to precipitate. Precipitated libraries were then pelleted, washed twice in 80% Ethanol, and resuspended in Pure H2O. Libraries were then quantified using NanoDrop and Agilent DNA High Sensitivity kit. For DM-tRNA-seq, libraries were constructed as using the TGIRT™ Improved Modular Template-Switching RNA-seq Kit (InGex, LLC), which utilizes Illumina-compatible adapters for amplification and sequencing purposes. Libraries were amplified using PCR primers supplied with the NEBNext Small RNA library Prep Set (NEB) and purified using Agencourt AMPure XP beads (Beckman). Resulting purified sequencing libraries were quantified using NanoDrop and Agilent DNA High Sensitivity kit. Libraries were then pooled equimolarly, and concentrated using a DNA Clean and Concentrate-5 (Zymo Research). Pooled PCR-amplified libraries were size-selected (140-250 nts) on a 6% non-denaturing TBE-acrylamide gel to remove unwanted primer dimer products. Libraries were eluted from gel pieces using Gel Elution Buffer (NEB) and precipitated using .3 M NaOAc, 80% Ethanol, and 1 uL of Linear Acrylamide (supplied in NEBNext Kit) at final concentration. Samples were left in -80C freezer overnight to precipitate. Precipitated libraries wer then pelleted, washed twice in 80% Ethanol, and resuspended in Pure H2O.
|
| |
|
| Library strategy |
ncRNA-Seq |
| Library source |
transcriptomic |
| Library selection |
size fractionation |
| Instrument model |
Illumina MiSeq |
| |
|
| Description |
total small RNA (≤ 250 nts)
|
| Data processing |
Adapters were removed and reads were merged with SeqPrep [John st. John unpub] using a minimum read length of 15 and adapters AGATCGGAAGAGCACACGTC and GATCGTCGGACTGTAGAACTC. Reads that could not be merged were discarded before mapping.
Data were analyzed with TRAX (https://github.com/UCSC-LoweLab/tRAX) with fragment counts disabled, TRAX maps reads using bowtie2 to a custom database containing mature tRNA transcripts and the genome sequence.
tRNAs were converted into genome space with TRAX and coverage tracks were created with bedGraphToBigWig and genomeCoverageBed from UCSC Genome Browser tools and BEDtools.
Genome_build: Mus musculus GRCm38/mm10
Supplementary_files_format_and_content: Processed data files are in bigwig format and can be visualized by uploading them into the UCSC Genome Browser. They contain the read coverage aligned to the reference genome.
|
| |
|
| Submission date |
Nov 07, 2019 |
| Last update date |
Nov 10, 2019 |
| Contact name |
Todd Lowe |
| E-mail(s) |
aimannin@ucsc.edu
|
| Organization name |
University of California Santa Cruz
|
| Department |
Biomolecular Engineering and Bioinformatics
|
| Lab |
Lowe Lab
|
| Street address |
1156 High Street
|
| City |
Santa Cruz |
| State/province |
CA |
| ZIP/Postal code |
95064 |
| Country |
USA |
| |
|
| Platform ID |
GPL16417 |
| Series (2) |
| GSE140096 |
AlkB-facilitated RNA methylation sequencing (ARM-seq) and Demethylase-thermostable group II intron RT tRNA sequencing (DM-tRNA-seq) [liver] |
| GSE140105 |
AlkB-facilitated RNA methylation sequencing (ARM-seq) and Demethylase-thermostable group II intron RT tRNA sequencing (DM-tRNA-seq) |
|
| Relations |
| BioSample |
SAMN13232604 |
| SRA |
SRX7115225 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM4154318_ARM_s500ng_minusAlkB_rep1.Minus.bw |
828.3 Kb |
(ftp)(http) |
BW |
| GSM4154318_ARM_s500ng_minusAlkB_rep1.Plus.bw |
837.3 Kb |
(ftp)(http) |
BW |
SRA Run Selector |
| Processed data provided as supplementary file |
| Raw data are available in SRA |
|
|
|
|
 |
