NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Sample GSM4154309 Query DataSets for GSM4154309
Status Public on Nov 08, 2019
Title Mouse Spleen M4 +AlkB ARM-seq
Sample type SRA
 
Source name C57BL/6J male mouse Spleen
Organism Mus musculus
Characteristics tissue: Whole Spleen
strain: C57BL/6J
Sex: male
Treatment protocol All samples were collected from said mice at 2-3 PM EST. All tissue samples were then flash-frozen in liquid nitrogen and stored in -80˚C freezer until use.
Growth protocol Samples were obtained from 3 C57BL/6J male 6-8 weeks old timepoints. Mice are housed in facilities with roughly 12 hr light-dark cycles (7AM-7PM light and 7PM-7AM dark)
Extracted molecule total RNA
Extraction protocol Isolation of total RNA from mouse Spleen tissue was performed using Direct-Zol RNA MiniPrep Kit (Zymo Research) with TRI Reagent (Molecular Research Center, Inc.), typically yielding 400–450 μg of total RNA. Appropriate amounts of TRI Reagents was added to each tissue sample, along with ~400 uL of zirconium silicate beads (1.0 mm), and samples were homoginized using a tissue homoginization centrifuge. Sample size (n = 3) was selected to demonstrate the utility of the protocol at a level of replication achievable by most researchers.30 μg of control or AlkB-treated RNA were processed using the MirVana miRNA Isolation Kit (Life Technologies), according to the manufacturer's instructions, to select for RNA <200 nt. RNA was concentrated to 30 μg using RNA Clean and Concentrate-25 (Zymo Research), and was treated with DNase I (New England BioLabs). Following column cleanup of the RNA, 700ng was used as input for NEBNext Small RNA Library Prep Kit for Illumina (New England BioLabs). Total Small RNA was isolated from Total RNA samples from each Spleen tissue sample using the miRvana small RNA isolation protocol (Life Technologies). Small RNA samples were divided and treated as minus AlkB control treatment and plus-AlkB experimental treatment. AlkB treatment was performed as previously described (Cozen et al. Nat Methods. 2015). All samples were then treated with T4PNK at pH 6.5 to maximize 3' phosphatase activity for 30 mins. Finally RNA was concentrated after each enzymatic treatment using an RNA clean and concentration-5 kit (Zymo Research). Treated RNA was used for library preparation.
For ARM-seq, libraries were constructed as previously described (Hrabeta-Robinson, et al. Methods Mol Biol. 2017) which utilizes the NEBNext Multiplex Small RNA Library Prep Set (NEB). For RNA-seq, and Panc1 RIP-seq, NEXTflex™ Rapid Directional qRNA-Seq™ For ARM-seq, 30 μg of control or AlkB-treated RNA were processed using the MirVana miRNA Isolation Kit (Life Technologies), according to the manufacturer's instructions, to select for RNA <200 nt. RNA was concentrated to 2ug using RNA Clean and Concentrate-25 (Zymo Research), and was treated with DNase I (New England BioLabs). Following column cleanup of the RNA, 700ng was used as input for NEBNext Small RNA Library Prep Kit for Illumina (New England BioLabs).
 
Library strategy ncRNA-Seq
Library source transcriptomic
Library selection size fractionation
Instrument model Illumina NextSeq 500
 
Description total small RNA (≤ 250 nts)
Data processing Adapters were removed and reads were merged with SeqPrep [John st. John unpub] using a minimum read length of 15 and adapters AGATCGGAAGAGCACACGTC and GATCGTCGGACTGTAGAACTC. Reads that could not be merged were discarded before mapping.
Data were analyzed with TRAX (https://github.com/UCSC-LoweLab/tRAX) with fragment counts disabled, TRAX maps reads using bowtie2 to a custom database containing mature tRNA transcripts and the genome sequence.
tRNAs were converted into genome space with TRAX and coverage tracks were created with bedGraphToBigWig and genomeCoverageBed from UCSC Genome Browser tools and BEDtools.
Genome_build: Mus musculus GRCm38/mm10
Supplementary_files_format_and_content: Processed data files are in bigwig format and can be visualized by uploading them into the UCSC Genome Browser. They contain the read coverage aligned to the reference genome.
 
Submission date Nov 07, 2019
Last update date Nov 10, 2019
Contact name Todd Lowe
E-mail(s) aimannin@ucsc.edu
Organization name University of California Santa Cruz
Department Biomolecular Engineering and Bioinformatics
Lab Lowe Lab
Street address 1156 High Street
City Santa Cruz
State/province CA
ZIP/Postal code 95064
Country USA
 
Platform ID GPL19057
Series (2)
GSE140095 AlkB-facilitated RNA methylation sequencing (ARM-seq) and Demethylase-thermostable group II intron RT tRNA sequencing (DM-tRNA-seq) [spleen]
GSE140105 AlkB-facilitated RNA methylation sequencing (ARM-seq) and Demethylase-thermostable group II intron RT tRNA sequencing (DM-tRNA-seq)
Relations
BioSample SAMN13232613
SRA SRX7115216

Supplementary file Size Download File type/resource
GSM4154309_ARM_Spleen_M4_plusAlkB.Minus.bw 1.2 Mb (ftp)(http) BW
GSM4154309_ARM_Spleen_M4_plusAlkB.Plus.bw 1.2 Mb (ftp)(http) BW
SRA Run SelectorHelp
Processed data provided as supplementary file
Raw data are available in SRA

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap