 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Jul 17, 2019 |
| Title |
OV8-WT-2 |
| Sample type |
SRA |
| |
|
| Source name |
ovary
|
| Organism |
Homo sapiens |
| Characteristics |
cell line: OVCAR8
genotype/variation: parental control
|
| Treatment protocol |
Three STAT3 CRISPR guide sequences (1: ACAATCCGGGCAATCTCCAT, 2: CATTCGACTCTTGCAGGAAG, 3: GAAACTGCCGCAGCTCCATT) were designed and purchased from Invitrogen™, ThermoFisher Scientific. In vitro transcription of the gRNA template was carried out with the MEGAshortscript™ T7 Transcription Kit using the manufacturer’s recommended conditions. The gRNA product was purified with the MEGAclearTM Transcription Clean-Up kit as described in the manual. RNA concentration was determined using a NanoDrop spectrophotometer. The percentage of locus-specific indel formation was measured and selected using the GeneArt® Genomic Cleavage Selection Kit (Invitrogen™, ThermoFisher Scientific). Target sequences were cloned into a cleavage selection vector, which contains the orange fluorescence protein (OFP) as a reporter for fluorescence-based cell sorting. The percentage of OFP-positive cells indicates the cleavage activity of CRISPR-Cas9. CRISPR-Cas9 mediated genome editing was performed as previously reported [42]. At 48 h post-transfection, the cells were harvested for analysis of genome modification efficiency using the GeneArt Genomic Cleavage Detection kit (Invitrogen™, ThermoFisher Scientific). Additionally, cells were analyzed by flow cytometry to identify the OFP-positive population and were sorted by FACS. A single clone isolation was further performed on sorted OFP-positive cells. The clones were screened by Western blot to assess STAT3 protein expression levels. STAT3 sequence in KO cells was confirmed with a homozygous 1 bp deletion by Sanger sequencing.
|
| Growth protocol |
OVCAR3, OVCAR8 and SKOV3 cells were purchased from National Cancer Institute, Bethesda, MD. HEY cells were kindly provided as a gift by Dr. Louis Dubeau (University of Southern California, CA). Mesenchymal stem cells were kindly provided as a gift by Dr. Karen McLean (University of Michigan, MI). All cells were grown as monolayers at 37°C in a humidified atmosphere of 5% CO2. All experiments were carried out using cells in the exponential growth phase. Cells were routinely checked for mycoplasma contamination with PlasmoTest (InvivoGen).
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Cells were lysed with TRIzol® Reagent (ThermoFisher Scientific) at room temperature. RNA was further purified with DirectZol kit (Zymo Research, Irvine, CA).
RNA quality was assessed using the TapeStation (Agilent Technologies, Santa Clara, CA). Samples with RINs (RNA Integrity Numbers) of 8 or greater were prepared with TruSeq Stranded mRNA Library Prep (Illumina) per the supplier’s protocol with 1ug of RNA and 12 cycles of PCR amplification. Libraries were checked for size on the TapeStation and quantified using the Kapa Biosystems library quantification kit (Illumina). The libraries were barcoded, pooled and sequenced on the HiSeq 4000 at the University of Michigan DNA Sequencing Core using 50bp single-end 50bp (OVCAR3 and OVCAR8) and paired-end 50bp (SKOV3) sequencing.
|
| |
|
| Library strategy |
RNA-Seq |
| Library source |
transcriptomic |
| Library selection |
cDNA |
| Instrument model |
Illumina HiSeq 4000 |
| |
|
| Data processing |
Reads were mapped to GRCh38 using STAR v2.5.2
Gene quantifications were calculated using Cufflinks v2.2.1 to quantify refGene annotations. Gene read counts calculated using featureCounts.
Genome_build: GRCh38
Supplementary_files_format_and_content: tab-delimited text files include FPKM values and read counts per gene for each Sample
|
| |
|
| Submission date |
Jul 16, 2019 |
| Last update date |
Jul 17, 2019 |
| Contact name |
Armand Bankhead |
| E-mail(s) |
bankhead@umich.edu
|
| Organization name |
University of Michigan
|
| Department |
Biostatistics
|
| Street address |
1415 Washington Heights
|
| City |
Ann Arbor |
| State/province |
MI |
| ZIP/Postal code |
48109 |
| Country |
USA |
| |
|
| Platform ID |
GPL20301 |
| Series (1) |
| GSE134375 |
Multi-omics profiling reveals key signaling pathways in ovarian cancer controlled by STAT3 |
|
| Relations |
| BioSample |
SAMN12286349 |
| SRA |
SRX6452586 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM3944454_OV8-WT-2.counts.txt.gz |
107.3 Kb |
(ftp)(http) |
TXT |
| GSM3944454_OV8-WT-2.fpkm.txt.gz |
326.2 Kb |
(ftp)(http) |
TXT |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data provided as supplementary file |
|
|
|
|
 |
