|
| Status |
Public on May 28, 2020 |
| Title |
UPF1_isoform_2_RIP-Seq_1 |
| Sample type |
SRA |
| |
|
| Source name |
HEK-293 Trex_UPF1_isoform_2_RIP-seq
|
| Organism |
Homo sapiens |
| Characteristics |
cell line: HEK-293 Trex cells genotype/variation: Expressing CLIP-UPF1_isoform_2 molecule subtype: Affinity-purified RNA
|
| Treatment protocol |
HEK-293TO cells were treated with 200 ng/mL doxycycline hyclate to induce transgene expression.
|
| Growth protocol |
HEK-293TO cells were maintained in DMEM supplemented with 10% FBS , 100 U/ml penicillin, 100 μg/ml streptomycin , and 0.3 mg/ml L-glutamine at 37°C and 5% CO2.
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Qiagen RNeasy Mini RNA isolation kit One μg of total RNA was used per sample for library preparation. Ribosomal RNA was depleted from total RNA with the Ribo-Zero rRNA Removal Kit (Epicentre), and purified RNA was then converted to cDNA with the TruSeq RNA Library Preparation Kit (Illumina).
|
| |
|
| Library strategy |
RIP-Seq |
| Library source |
transcriptomic |
| Library selection |
other |
| Instrument model |
Illumina HiSeq 3000 |
| |
|
| Description |
UPF1_2_S1-IP
|
| Data processing |
Reads were trimmed using Cutadapt with the following parameters: --match-read-wildcards --times 2 -e 0 -O 5 -q 6 -m 18 -b TCGTATGCCGTCTTCTGCTTG -b ATCTCGTATGCCGTCTTCTGCTTG -b CGACAGGTTCAGAGTTCTACAGTCCGACGATC -b TGGAATTCTCGGGTGCCAAGG -b AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA -b TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT Trimmed reads were quantified using Kallisto software with parameters --bias -b 1000 -t 16 --single --rf-stranded -l 200 -s 20 and differential expression analysis was performed with Sleuth software. Genome_build: hg19 Supplementary_files_format_and_content: Tab-delimited file contains TPM values for each replicate, average TPM values for each condition, log2 fold-change values for RNA abundance in Input samples, average and individual RIP-Seq efficiency calculations (IP/Input TPM), and statistical parameters from Sleuth analysis of Input RNA-Seq samples.
|
| |
|
| Submission date |
Jul 09, 2019 |
| Last update date |
May 28, 2020 |
| Contact name |
J. Robert Hogg |
| E-mail(s) |
j.hogg@nih.gov
|
| Organization name |
National Heart, Lung, and Blood Institute
|
| Department |
Biochemistry and Biophysics Center
|
| Street address |
50 South Drive, Room 2341
|
| City |
Bethesda |
| State/province |
MD |
| ZIP/Postal code |
20892 |
| Country |
USA |
| |
|
| Platform ID |
GPL21290 |
| Series (1) |
| GSE134059 |
UPF1 regulatory loop variant RNA-Seq and RIP-Seq |
|
| Relations |
| BioSample |
SAMN12239865 |
| SRA |
SRX6423018 |