 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Aug 21, 2019 |
| Title |
20 SS, all skin, replicate A |
| Sample type |
SRA |
| |
|
| Source name |
FACS-isolated all skin cells from whole embryos
|
| Organism |
Danio rerio |
| Characteristics |
strain: AB+TU developmental stage: 20 SS tissue: FACS all skin Sex: pooled male and female biomaterial provider: Fang Wang (CSUDH) birth location: UCLA genotype: krt4:DsRed
|
| Treatment protocol |
Transgenic embryos without further treatment
|
| Growth protocol |
Zebrafish were maintained in 28.5 C and pH 7.5 fish water. Adults were kept in a 14-hour light / 10-hour dark cycle.
|
| Extracted molecule |
polyA RNA |
| Extraction protocol |
Dechorionated embryos were transferred into 1.5 ml tubes and rinsed with Ca2+-free Ringer’s solution for 15 min. During this incubation, yolk was removed by gently pipetting embryos through a 200 µl tip (with the end cut off) three to five times. Yolk-free embryos were transferred into a 35 mm petri dish with 5 ml of 0.25% Trypsin-EDTA. Embryos were incubated at 28.5 °C and homogenized with a 200 µl tip every 10 min until most cells were dissociated (20 to 50 min). 55 µl 100 mM CaCl2 and 550 µl FCS were added to stop digestion. Dissociated cells were transferred into a 15 ml tube and centrifuged at 300 g for 5 min at 15 °C. Cells were rinsed once with 10 ml suspension solution (colorless Leibovitz medium L-15 with 0.3 g/L glutamine, 0.8 mM CaCl2, Pen 50U/ml, Strep 0.05 mg/ml, and 1% FCS). Dissociated cells were resuspended in suspension solution to ~10^7 cells/ml and immediately proceeded to cell sorting at the UCLA Broad Stem Cell Research Center Flow Cytometry Core. BD FACS ARIA II SORP instruments sorted cells, using a 488 nm laser for GFP detection and a 561 nm laser for RFP (dsRed) detection. Sorted cells in suspension solution were immediately lysed using the Qiagen RNeasy kit. Lysis was completed within two hours of dissociating cells. Total RNA was isolated following the Qiagen RNeasy kit and stored at –80 °C. Quality of all samples was assayed with an Agilent Bioanalyzer, and only samples with RNA Integrity Number > 8 were used for creating sequencing libraries. Poly-A bead-purified RNA-Seq libraries were prepared with the Illumina TruSeq RNA Library Prep Kit.
|
| |
|
| Library strategy |
RNA-Seq |
| Library source |
transcriptomic |
| Library selection |
cDNA |
| Instrument model |
Illumina HiSeq 2500 |
| |
|
| Data processing |
Demultiplexing: single mismatch to expected 7-mers, only keeping PF=1 spots Adapter, low quality base trimming: CutAdapt 1.8.1 (-m 21 --trim-n --max-n=2 -q 10,10 -a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC), then only keeping reads >=47 nt long and only keeping the first 47 nt of those reads Alignment: STAR 2.5.3a (to genome and transcriptome, single pass mode with known junctions), retaining multiple locations for non-uniquely aligning reads (see paper or BAMs for parameters) Quantification: Salmon patched 0.10.2 (--numGibbsSamples=1000 --thinningFactor=25 --useVBOpt --libType=U --fldMean=200 --fldSD=200 --rangeFactorizationBins=4 --minAssignedFrags=1 --seqBias --noBiasLengthThreshold), with 1,000 Gibbs samples per experiment Statistics: see paper; similar to R Bioconductor Sleuth (with Wasabi as importer), but elaborated and with some DESeq2 features incorporated Genome_build: Ensembl release 92 top-level reference Zebrafish genome (GRCz11 chr1..25 + MT + 847/120 KN/KZ scaffolds) + PhiX, and associated Ensembl genebuild annotations/models Supplementary_files_format_and_content: GZIP-TAR-Salmon files: GZIP-compressed TAR archives of Salmon transcript quantification output filesystem trees. Supplementary file: Microsoft Excel workbook in XLSX format, with multiple worksheets, containing a comprehensive collection of analysis input data, intermediate steps, and statistical outputs (see column headers as well as Methods and Supplemental methods of the associated journal publication).
|
| |
|
| Submission date |
Jun 06, 2019 |
| Last update date |
Aug 21, 2019 |
| Contact name |
Shawn J. Cokus |
| Organization name |
UCLA
|
| Street address |
UCLA, 3000 Terasaki Life Sciences Building, 610 Charles Young Drive East
|
| City |
Los Angeles |
| State/province |
CA |
| ZIP/Postal code |
90095 |
| Country |
USA |
| |
|
| Platform ID |
GPL18413 |
| Series (1) |
| GSE132304 |
Tissue-specific transcriptomes reveal gene expression trajectories in two maturing skin epithelial layers in zebrafish embryos |
|
| Relations |
| BioSample |
SAMN11969602 |
| SRA |
SRX5982375 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM3855892_ZFishSkin_Salmon_c03_20SS--allSkin-_repA_i02.CGATGTA.pf1.XA025L6.tar.gz |
299.6 Mb |
(ftp)(http) |
TAR |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data provided as supplementary file |
| Processed data are available on Series record |
|
|
|
|
 |