 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Mar 05, 2020 |
| Title |
Glucose GEnC derived EVs2 [miRNA-seq] |
| Sample type |
SRA |
| |
|
| Source name |
Podocytes
|
| Organism |
Homo sapiens |
| Characteristics |
podocyte treatment: GEnC derived EVs genc treatment: Glucose
|
| Treatment protocol |
GENCs were incubated in microvascular cell growth kit media supplemented with 5% exosome depleted FBS. GEnCs were either unstimulated (steady state, SS), or stimulated with glucose (Glu, 30mmol), or puromycin aminonucleoside (PAN, 100ug/mL) for 24hr. Cell supernatants were spun at 300g for 10 min, then 2,000g for 15min, and then ultracentrifuged for 10,000g for 30min to remove cell debris and large EVs. Equal supernatant volumes were then ultracentrifuged at 100,000g for 70min at 4℃. EV pellets were resuspended in 300uL of podocyte media plus 5% exosome depleted FBS. 2x10^5 podocytes were untreated (UT) or treated with EVs from GEnCs from SS, Glu or PAN conditions for 24hr.
|
| Growth protocol |
GEnCs were incubated at 33℃ in 5% CO2 to proliferate in microvascular cell growth kit, then thermoswitched at 37℃, 5% CO2 in attachment factor coated plates. Podocytes were incubated at 33℃ in 5% CO2 in RPMI supplemented with 10% PS, 25% FCS, 5% L-glutamine, and 5% ITS. Cells were induced to differentiate at 37℃ in 5% CO2.
|
| Extracted molecule |
total RNA |
| Extraction protocol |
RNA from 2x10^5 podocytes incubated for 24h with EVs derived from GEnCs was isolated using the Total RNA Purification Kit (Norgen Biotec) according to the manufacturer's instructions. Libraries were prepared using the Bioo Scientific NEXTflex Small RNA-Seq Kit v3
|
| |
|
| Library strategy |
miRNA-Seq |
| Library source |
transcriptomic |
| Library selection |
size fractionation |
| Instrument model |
Illumina NextSeq 500 |
| |
|
| Data processing |
Pipeline: TIGER https://www.ncbi.nlm.nih.gov/pubmed/30128086 Step 1: Pre-processing: To assess raw data quality, FastQC was performed at the raw read level to check for base quality, total read counts, and adapter identification. Cutadapt was then used to trim 3’ adapters from processed reads (-a TGGAATTCTCGGGTGCCAAGG). Cutadapt was then used to remove the first and last 4 bases from the trimmed reads and all trimmed reads <16 nts in length were removed (-m 16 -u 4 -u -4). After trimming, read length distributions were plotted and FastQC was performed on trimmed reads to validate the efficiency of adapter trimming. To generate identical read files, trimmed reads in each sample were collapsed into non-redundant “identical” reads in FASTQ format and copy numbers were recorded for downstream analysis. Step 2: Genome Alignment (Human) In the Host Genome & Database alignment module, bowtie (v1.1.2) was used to map reads to a costumed database with option (-a -m 100 --best - strata -v 1) which allows 1 mismatch (MM) and 100 multi-mapped loci, and only the best matches were recorded. Counting and differential expression analysis of miRNAs were performed. All prepossessed quality reads were assigned to different classes of annotated sRNAs using distinct rules -- miRNA: 1 MM, ≥16nt, offset -2, -1, 0, 1, 2. Differential expression of tabulated read counts were performed by DEseq2. Genome_build: human GRCh37
|
| |
|
| Submission date |
Apr 16, 2019 |
| Last update date |
Mar 05, 2020 |
| Contact name |
Danielle L Michell |
| E-mail(s) |
danielle.michell@vumc.org
|
| Organization name |
Vanderbilt Univ. Medical Center
|
| Department |
Department of Medicine
|
| Lab |
312 Preston Research Bldg
|
| Street address |
2220 Pierece Ave
|
| City |
Nashville |
| State/province |
TN |
| ZIP/Postal code |
37232 |
| Country |
USA |
| |
|
| Platform ID |
GPL18573 |
| Series (2) |
| GSE129888 |
sRNA-seq of podocytes treated with glomerular endothelial cell vesicles |
| GSE129892 |
Glomerular endothelial derived vesicles mediate podocyte dysfunction via extracellular transfer of miRNA-200c-3p |
|
| Relations |
| BioSample |
SAMN11439320 |
| SRA |
SRX5695127 |
| Supplementary data files not provided |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data are available on Series record |
|
|
|
|
 |