NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Sample GSM364536 Query DataSets for GSM364536
Status Public on Sep 08, 2009
Title Illumina sequenced synthetic miRNA sample B with barcode 4
Sample type SRA
 
Source name Sample B
Organism Homo sapiens
Characteristics sample: synthetic miRNA
Biomaterial provider Integrated DNA Technologies
Treatment protocol n/a
Growth protocol n/a
Extracted molecule other
Extraction protocol n/a
 
Library strategy OTHER
Library source transcriptomic
Library selection other
Instrument model Illumina Genome Analyzer
 
Description Illumina barcode 4 (TACA)
Illumina multiplexed sequencing
Data processing The GAPipeline-1.0 was used starting from the IPAR-1.01 calculated intensities.
The adapter sequences were trimmed in 3 steps:
(NB: 3' special adapter: CTGTAGGCACCATCAATCGTA)
1) The 21nt adapter sequence is used, which permits to identify “inserts” of 11nt or less.
2) If no adapter sequence was found, in successive steps the last base of the adapter was removed and the sequence was searched at the end of the reads. The minimum adapter size of 6 bases permits identifying inserts of up to 26 bases.
3) Finally the remaining reads are search for notexact matches of the adapter. The first 5 bases of the adapter were searched within the full reads sequences and at least 80% of the following bases must be identical to the adapter sequence (max 26 bp).
 
Submission date Jan 26, 2009
Last update date Jun 11, 2013
Contact name Hanni Willenbrock
E-mail(s) hanni@cbs.dtu.dk
Phone +45 45 66 09 85
Organization name DTU
Department Center for Biological Sequence Analysis
Street address Kemikalievej, bygning 208
City Kgs. Lyngby
ZIP/Postal code 2800
Country Denmark
 
Platform ID GPL9052
Series (1)
GSE14511 Quantification of synthetic miRNAs
Relations
BioSample SAMN02195517

Data table header descriptions
SEQUENCE
Concentration concentration of the sequence in amol/ul
COUNT number of times sequenced

Data table
SEQUENCE Concentration COUNT
hsa-let-7e* 23.5294117647059 0
hsa-let-7g 23.5294117647059 56
hsa-miR-125a-5p 23.5294117647059 10
hsa-miR-139-5p 23.5294117647059 0
hsa-miR-181d 23.5294117647059 33
hsa-miR-182* 23.5294117647059 11
hsa-miR-193a-3p 23.5294117647059 0
hsa-miR-197 23.5294117647059 0
hsa-miR-222 23.5294117647059 0
hsa-miR-24-2* 23.5294117647059 0
hsa-miR-302a 23.5294117647059 10
hsa-miR-30e 23.5294117647059 1
hsa-miR-335* 23.5294117647059 0
hsa-miR-33a 23.5294117647059 135
hsa-miR-33b* 23.5294117647059 1
hsa-miR-342-3p 23.5294117647059 1
hsa-miR-361-5p 23.5294117647059 1
hsa-miR-432 23.5294117647059 2214
hsa-miR-449b 23.5294117647059 2
hsa-miR-485-5p 23.5294117647059 1680

Total number of rows: 744

Table truncated, full table size 20 Kbytes.




Supplementary file Size Download File type/resource
GSM364536.zip.gz 23.3 Mb (ftp)(http) ZIP
Processed data included within Sample table
Raw data provided as supplementary file

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap