|
| Status |
Public on Sep 08, 2009 |
| Title |
Illumina sequenced synthetic miRNA sample A with barcode 3 |
| Sample type |
SRA |
| |
|
| Source name |
Sample A
|
| Organism |
Homo sapiens |
| Characteristics |
sample: synthetic miRNA
|
| Biomaterial provider |
Integrated DNA Technologies
|
| Treatment protocol |
n/a
|
| Growth protocol |
n/a
|
| Extracted molecule |
other |
| Extraction protocol |
n/a
|
| |
|
| Library strategy |
OTHER |
| Library source |
transcriptomic |
| Library selection |
other |
| Instrument model |
Illumina Genome Analyzer |
| |
|
| Description |
Illumina barcode 3 (GTAA)
Illumina multiplexed sequencing
|
| Data processing |
The GAPipeline-1.0 was used starting from the IPAR-1.01 calculated intensities.
The adapter sequences were trimmed in 3 steps:
(NB: 3' special adapter: CTGTAGGCACCATCAATCGTA)
1) The 21nt adapter sequence is used, which permits to identify “inserts” of 11nt or less.
2) If no adapter sequence was found, in successive steps the last base of the adapter was removed and the sequence was searched at the end of the reads. The minimum adapter size of 6 bases permits identifying inserts of up to 26 bases.
3) Finally the remaining reads are search for notexact matches of the adapter. The first 5 bases of the adapter were searched within the full reads sequences and at least 80% of the following bases must be identical to the adapter sequence (max 26 bp).
|
| |
|
| Submission date |
Jan 26, 2009 |
| Last update date |
Jun 11, 2013 |
| Contact name |
Hanni Willenbrock |
| E-mail(s) |
hanni@cbs.dtu.dk
|
| Phone |
+45 45 66 09 85
|
| Organization name |
DTU
|
| Department |
Center for Biological Sequence Analysis
|
| Street address |
Kemikalievej, bygning 208
|
| City |
Kgs. Lyngby |
| ZIP/Postal code |
2800 |
| Country |
Denmark |
| |
|
| Platform ID |
GPL9052 |
| Series (1) |
| GSE14511 |
Quantification of synthetic miRNAs |
|
| Relations |
| BioSample |
SAMN02195512 |
