 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Dec 04, 2018 |
| Title |
Input_A_DSGPFA_4 |
| Sample type |
SRA |
| |
|
| Source name |
Tg2a_Input_A_DSGPFA_4
|
| Organism |
Mus musculus |
| Characteristics |
cell line: Tg2a
cell type: embryonic stem cells
fixative: DSGFA
cellcycle: I
chip antibody: none (Input)
barcode: 0
|
| Treatment protocol |
ChIP-seq and MNase-seq: E14tg2a cells grown in T150 flasks were treated for 4-5 h with 50 ng×ml−1 nocodazole. Shake-off was performed and the cell suspension was filtered through a 10µm filter (pluriSelect, Cat# 43-50010-03). For interphase samples, untreated cells were trypsinised and collected in parallel.
Cell-cycle RNA-seq: GFP Sox2-AID ES cells were cultured in the presence of 0.5mM of auxin (Sigma, Cat# I5148) for 3 hours. During the last 20 minutes 20μM Hoechst-33342 was added.
|
| Growth protocol |
ES cells were cultured on 0.1% gelatine in DMEM + GlutaMax-I (Gibco, Cat# 31966-021) 10% FCS, 100 μM 2-mercaptoethanol, 1× MEM non-essential amino acids, and 10 ng×ml−1 recombinant LIF (MILTENYI BIOTEC, Cat# 130-099-895). When required medium was supplemented with 1 µM PD0325901 and 3 µM CHIR99021 (Axon Medchem Bv).
|
| Extracted molecule |
genomic DNA |
| Extraction protocol |
ATAC-Seq: 5x104 cells pellets were resuspended in 25 µl TD buffer (Nextera kit; Illumina, Cat# FC-121-1030). After the addition of 2.5 µl of transposase TDE1 and 22.5 µl nuclease free water, reactions were mixed and incubated for 30min at 37oC. Reactions were stopped by adding the appropriate volume of Binding Buffer and the DNA was purified using the Qiagen MinElute PCR Kit according to manufacturer’s protocol. The purified DNA was either stored at -20oC or used directly for library preparation.
ATAC-seq: Reactions were prepared mixing 10 µl transposed DNA, 2.5 µl 25 µM primer Ad1.noMX, 2.5 µl 25 µM primer Ad2 from (Buenrostro et al. 2013), 9 µl Nuclease Free Water, 1 µl of a 1:8 dilution of Quant-iT Picogreen dye (Invitrogen, Cat# P11496) and 25µl of KAPA HiFi HotStart 2× Master Mix (Kapa Bioscience Cat# KK2502). Amplification was carried out under the following conditions: Pre-amplification: 1 cycle: 5’ at 72°C; 30” at 98°C; 5 cycles: 10” at 98°C; 30” at 63°C; 1’ at 72°C; Amplification: 1 cycle: 30” at 98°C; 11/12 cycles: 10” at 98°C; 30” at 63°C; 1’ at 72°C. After amplification libraries were purified with SPRI beads, using a sample to bead ratio of 1: 1.4.
Cell-cycle RNA-seq: ES cells were sorted on the basis of Hoechst and GFP levels in three populations (early G1, late G1 and G2) as previously described (Festuccia et al. 2016). RNA was extracted with TRIzol (ThermoFisher, Cat# 15596026). Samples were DNAse I treated (Qiagen, Cat# 79254), phenol/chloroform extracted and ethanol precipitated.
ChIP-seq and MNase-seq: Precipitated DNA was resuspended in 37.5µl of water and mixed with 2µl of 10mM dNTPs, 5µl of NEB T4 ligase buffer, 2.5µl of NEB T4 polymerase (Cat# M0203L), 0.5µl of NEB Klenow polymerase (Cat# M0210L) and 2.5µl of NEB T4 PNK (Cat# M0201L). Samples were incubated 30min at 20oC. DNA was purified with 90µl of SPRI beads and 50µl isopropanol and eluted in 21µl of water. DNA was mixed with 2.5µl of NEB Buffer #2, 1µl of 5mM dATP, 1.5µl of NEB Klenow 3'-5' exo minus (Cat# M0212L), and incubated at 37oC for 30min. DNA was purified with SPRI beads as before, but using a volume of 45µl of beads and 25µl isopropanol. DNA was elute in 20µl of water and mixed with 2.5µl of NEB T4 ligase buffer, 1.25µl of a 0.2µM solution of annealed adapters (See below), and 2.5µl of NEB concentrated T4 ligase (Cat# M0202M) and incubated overnight at 16oC. DNA was purified with SPRI beads as before, but using a volume of 35µl of beads and no isopropanol, eluting in 20 µl of water. Sample were mixed with 1µl of a 1:10 dilution of Quant-iT Picogreen dye (Invitrogen, Cat# P11496), 25µl of KAPA HiFi HotStart 2× master Mix (Kapa Bioscience Cat# KK2502), 1µl of 10µM PCR 1.0 and 1µl of PCR 2.0 Illumina primers. The amplification mix was distributed in two wells of a LightCycler 384 plate (Roche, Cat# 4729749001) and on a LightCycler 480 II instrument (Roche, Cat# 05015243001) using the following program: 1’ at 98°C; N cycles: 10” at 98°C; 20” at 64°C; 45” at 72°C. The number of cycles N was determined on real time by monitoring the fluorescence such that the amplification was stopped during the exponential phase. Samples were removed from the plate and purified with SPRI beads using 70µl beads, no isopropanol, and eluting in water. Barcoded adaptor: 5’P-GATCGGAAGAGCACACGTCTGAACTCCAGTCAC-IIIIII-NNNNNNNN-ATCTCGTATGCCGTCTTCTGCTTG. 5’P indicates the presence of a 5’phosphate group. IIIIII represent the six base index nucleotides, and NNNNNNNN a stretch of 8 random nucleotides used for single molecule barcoding. Universal adapter: AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATC*T. * indicates the presence of a phosphorothioate bond between the last C and T.
ChIP-seq/Mnase-seq Chromatin preparation: Interphase cells were resuspended in 2 ml of swelling buffer (25 mM Hepes pH 7.95, 10 mM KCl, 10 mM EDTA) and 0.5% IGEPAL. After 30 min on ice, the suspension was passed 40 times in a dounce homogenizer. Both mitotic and interphase cells were resuspended in 300 μl of TSE150 (0.1% SDS, 1% Triton X-100, 2 mM EDTA, 20 mM Tris-HCl pH8, 150 mM NaCl) buffer, freshly supplemented with 1× PIC. Samples were sonicated in 1.5 ml tubes (Diagenode) using a Bioruptor Pico (Diagenode) for 7 cycles divided into 30 s ON–30 s OFF sub-cycles at maximum power. After centrifugation (30 min, full speed, 4 °C), the supernatant was either used immediately for immunoprecipitation or stored at −80 °C until use.
ChIP-seq: Chromatin was pre-cleared for 3 hours rotating on-wheel at 4 °C in 300 μl of TSE150 containing 50 μl of protein G Sepharose beads 50% slurry, previously blocked with BSA and yeast tRNA. Immunoprecipitations with anti-ESRRB mouse monoclonal (1µg per 2x106cells, 5 μg per 107 cells; Perseus Proteomics, Cat# H6-705-00), anti-NANOG rabbit polyclonal (0.6 μg per 2x106cells, 3 μg per 107 cells; Cosmobio, Cat# REC-RCAB001P); anti-POU5F1 goat polyclonal (0.6 μg per 2x106cells, 3 μg per 107 cells; Santa Cruz Biotechnology, Cat # sc-5279); anti-SOX2 goat polyclonal (0.6 μg per 2x106cells, 3 μg per 107 cells; Santa Cruz Biotechnology, Cat # sc- 17320), were performed overnight rotating on-wheel at 4 °C in 500 μl of TSE150. Twenty-five microliters of blocked protein G beads 50% slurry was added for 4 h rotating on-wheel at 4 °C. Beads were pelleted and washed for 5 min rotating on-wheel at room temperature with 1 ml of buffer in the following order: 3 × TSE150, 1 × TSE500 (as TSE150 but 500 mM NaCl), 1× washing buffer (10 mM Tris-HCl pH8, 0.25M LiCl, 0.5% NP-40, 0.5% Na-deoxycholate, 1 mM EDTA), and 2 × TE (10 mM Tris-HCl pH8, 1 mM EDTA). Elution was performed in 100 μl of elution buffer (1% SDS, 10 mM EDTA, 50 mM Tris-HCl pH 8) for 15 min at 65 °C after vigorous vortexing. Eluates were collected after centrifugation and beads rinsed in 150 μl of TE-SDS1%. After centrifugation, the supernatant was pooled with the corresponding first eluate. For both immunoprecipitated and input chromatin, the crosslinking was reversed overnight at 65 °C, followed by proteinase K treatment, phenol/chloroform extraction and ethanol precipitation.
Chip-seq: Fixation DSG+FA. ES cells were crosslinked in PBS-DSG 2 mM at pH 7.0 (Sigma, Cat# 80424-5 mg) for 50 min at room temperature with occasional shaking and incubated for 10 min in 2 ml PBS 1% formaldehyde after washing in PBS. Crosslinking was stopped with 0.125 mM glycine for 5 min at room temperature. Fixation FA: ES cells crosslinked in 3 ml of pre-warmed DMEM/FCS/LIF for 10 min at room temperature adding 1% formaldehyde (Thermo, Cat# 28908). Crosslinking was stopped with 0.125 M glycine for 5 min at room temperature.
H3 ChIP-seq: ChIP was performed as described using 5 µg of anti-Histone H3 rabbit polyclonal (Abcam, Cat# ab1791).
MNase-seq: Cells fixed in formaldehyde as for ChIP were pre-incubated for 10 min at 37°C and ½ U, 16 U or 128 U of MNase (Expressed in KUntiz, 1 Kunitz is equivalent to 10 gel units, NEB Cat# M0247S) added to the reaction. Cells were incubated for further 10 min at 37°C, inverting the tubes occasionally. The reaction was stopped on ice by adding 500ul of 2 × STOP buffer (2% Triton X-100, 0.2% SDS, 300mM NaCl, 10mM EDTA). Tubes were left rotating overnight on a wheel to allow diffusion of the digested fragments. The cell suspension was spun down and the supernatant stored at -80°C. Samples were then incubated over night at 65°C in TE 1% SDS to revert the crosslinking, and treated with Proteinase K. DNA was phenol/chloroform extracted, ethanol precipitated, and RNase treated. 50 µl of DNA was purified with 90µl of SPRI beads and 50 µl isopropanol.
RNA-seq:Ribo-depleted, stranded and paired-end RNA-seq libraries were prepared and sequenced by Novogene Co Ltd.
|
| |
|
| Library strategy |
ChIP-Seq |
| Library source |
genomic |
| Library selection |
ChIP |
| Instrument model |
Illumina HiSeq 2500 |
| |
|
| Data processing |
ChIP-seq: Reads aligned with Bowtie2 with options “-k 10”. Reads were filtered for mapping quality 255 and edit distance <= 4. Reads with identical barcode, alignment position & strand were treated as PCR-duplicates and collapsed. Peaks called with MACS2 with options “callpeak -q 0.2 -g mm”. BigWig files were generated by extending reads to mean fragment length.
Mnase-seq & ATAC-seq: Paired end reads were trimmed by alignment for reverse complementary regions surrounded by relevant adapters. Reads were aligned using Bowtie2 with options “-k 10 -I 0 -X 1000 --no-discordant --no-mixed”. Pairs were filtered for mapping quality 255 and mean edit-distance <= 4.
RNA-seq: Stranded Reads pairs were aligned to the mm9 genome using RSEM-STAR pipeline with options “--seed 1618 --calc-pme --calc-ci --estimate-rspd --forward-prob 0.0 –paired-end”.
MNase/ATAC-seq Meta Plot Library: Mid-points of MNase-fragments (140-200 bp), cut sites of ATAC-seq fragments (0-100 bp), counted at base pair resolution and normalised per million reads, in +/- 1000bp of TSS, EP300 summits, Esrrb Bookmarked Sites, Esrrb Lost Sites and Oct4/Sox2 sites. Mid-point/cutsite data smoothed by sparse Gaussian process regression using Gpy.
Genome_build: mm9
Supplementary_files_format_and_content: ChIP-seq: BigWig files, MNase-seq/ATAC-seq: Library of meta-plots in tab-separated format; RNA-seq: Raw and normalised read-counts tab-separated format.
|
| |
|
| Submission date |
Nov 15, 2018 |
| Last update date |
Dec 05, 2018 |
| Contact name |
Pablo Navarro |
| E-mail(s) |
pnavarro@pasteur.fr
|
| Phone |
+33145688285
|
| Organization name |
Institut Pasteur
|
| Street address |
25 rue du Docteur Roux
|
| City |
paris |
| ZIP/Postal code |
75015 |
| Country |
France |
| |
|
| Platform ID |
GPL17021 |
| Series (1) |
| GSE122589 |
Transcription factor activity and nucleosome organisation in mitosis |
|
| Relations |
| BioSample |
SAMN10432365 |
| SRA |
SRX5023718 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM3475318_input-R3A.bw |
451.7 Mb |
(ftp)(http) |
BW |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data provided as supplementary file |
|
|
|
|
 |
