|
| Status |
Public on Jul 08, 2019 |
| Title |
OE_Input |
| Sample type |
SRA |
| |
|
| Source name |
Embryonic stem cell
|
| Organism |
Mus musculus |
| Characteristics |
strain: 12910la
cell line: J1
genotype: Zscan4 overexpression
|
| Treatment protocol |
The CDS region of Zscan4c was cloned into pCMV-FLAG vector.WT mESCs were transfected with 1000ng pCMV-tag2 vector.After transfection for 24h,the cells were treated with 500ug/ml G418 for 10days and the medium were changed every 24h, then we picked monoclonal cells.
|
| Growth protocol |
Mouse J1 embryonic stem cells (ESCs) were cultured under 5% CO2 at 37℃ on well plate coated with 0.2% gelatin(Sigma),in medium(Hyclone) that supplement with15% FBS（Hyclone）,10ng/ml mLIF (GeneScript)，1% Penicillin-Streptomycin (Solarbio)，1% GlutaMAX(Solarbio), 1% nonessential amino acids(Gibco), 0.1 mM β-mercaptoethanol (Sigma). .
|
| Extracted molecule |
genomic DNA |
| Extraction protocol |
Cells were lysed and chromatin was extracted. Anti-FLAG antibody was used to immunoprecipiate FLAG-Zscan4 in mESCs. Proteins on chromatin associated with Zscan4 was digested and chromatin was decrosslinked at 65 degree overnight. DNA was extracted in phenol-chloroform.
For ChIP-seq, 5ng of Zscan4-assocated chromatin DNA was used in ChIP-seq library preparation. Libraries were prepared according to Illumina protocols and library fragments of ~250 bp were used for sequencing.
|
| |
|
| Library strategy |
ChIP-Seq |
| Library source |
genomic |
| Library selection |
ChIP |
| Instrument model |
HiSeq X Ten |
| |
|
| Data processing |
Illumina RTA software used for image identification and basecalling.
Adaptor sequence and low-quality sequence were trimmed by Cutadapt with parameters " -q 5 -m 30 -n 4 -O 1 -a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -A AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT", then sequence reads were mapped to mm10 genome using Bowtie2 with parameters "-5 1 --very-sensitive -p 20 -I 0 -X 1000 --no-mixed --no-discordant --un-conc-gz".
Zscan4 peak bed file was called by macs2 with parameters "-f BAMPE -g mm -q 0.1 --keep-dup auto".
Zscan4 enrichment bigwig file was generated by bamCompare from Deeptools with parameter "--scaleFactorsMethod readCount -e --minMappingQuality 1 --samFlagExclude 256 --pseudocount -1 --operation ratio"
Genome_build: mm10
Supplementary_files_format_and_content: bed file of Zscan4 peaks and bigwig file of Zscan4 enrichment.
|
| |
|
| Submission date |
Oct 09, 2018 |
| Last update date |
Mar 29, 2020 |
| Contact name |
Weiyu Zhang |
| E-mail(s) |
ch8316f5eyu@gmail.com
|
| Phone |
18902012072
|
| Organization name |
Nankai University
|
| Street address |
No.38 Tongyan Road, Jinnan District
|
| City |
Tainjin |
| ZIP/Postal code |
300350 |
| Country |
China |
| |
|
| Platform ID |
GPL21273 |
| Series (1) |
| GSE125238 |
CHIP-seq analysis about Histones and Zscan4 after Zscan4 overexpression |
|
| Relations |
| BioSample |
SAMN10221862 |
| SRA |
SRX7992672 |
| SRA |
SRX4817755 |
