 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Oct 02, 2019 |
| Title |
SNU16 4C-seq, rep1 |
| Sample type |
SRA |
| |
|
| Source name |
gastric cancer cell line
|
| Organism |
Homo sapiens |
| Characteristics |
cell line: SNU16
|
| Extracted molecule |
genomic DNA |
| Extraction protocol |
10 million cells were cross-linked for 10 min with 1 % paraformaldehyde at RT, quenched with glycine, and lysed in 50 mL lysis buffer (50 mM Tris pH 7.5, 150 mM NaCl, 0.5 % NP-40, 1 % TX-100 and 1X protease inhibitors) for 30 min. Nuclei were then digested by NLAIII enzyme followed by inactivation of the restriction enzyme by incubating at 65 °C for 20 min. The digested chromatin was subsequently ligated (circularized) overnight at 16 °C with 3000 U T4 ligase (NEB). Ligated chromatin was then reverse cross-linked by incubating with proteinase K at 65 °C and the RNA was removed by additional incubation at 37 °C with RNase A. The purified DNA was further digested with CSP6I restriction enzyme followed by circularization of the DNA. 4C products were subsequently amplified with bait-specific inverse primers, pooled and purified. Amplified bait-containing DNA fragments were ligated to NEB adaptors. Adaptor-ligated DNA was purified by Agencourt AMPure XP purification system (Beckman Coulter, A63881), PCR amplified (eight cycles) using NEB index primers, and sequenced on the Illumina HiSeq3000 to obtain 150 bp long reads.
|
| |
|
| Library strategy |
OTHER |
| Library source |
genomic |
| Library selection |
other |
| Instrument model |
Illumina HiSeq 3000 |
| |
|
| Description |
4C-seq in SNU16
|
| Data processing |
Library strategy: 4C-seq
The package 4Cseqpipe was used to map, normalize and visualize 4C-seq data, as described in van de Werken et al., 2012. Custom restriction site tracks were built using the -build_re_db option of 4Cseqpipe for the hg19 human genome version (UCSC) and CATG and GTAC as first and second cutters, respectively. 4C primers (CACCTATTTTTCTTGTCATG) were removed from the reads and were then mapped to the custom hg19 tracks with the in-built 4Cseqpipe mapper. The 80th quantile of the distribution of normalized contact intensities for 2kb windows were put into wig files for visualization using the UCSC genome browser hg19 version
Genome_build: hg19
Supplementary_files_format_and_content: Refer the following URL for the wiggle format: https://genome.ucsc.edu/goldenpath/help/wiggle.html
|
| |
|
| Submission date |
Aug 29, 2018 |
| Last update date |
Oct 02, 2019 |
| Contact name |
Wen Fong Ooi |
| E-mail(s) |
gis.ooiwf@gmail.com
|
| Organization name |
Genome Institute of Singapore
|
| Street address |
60 Biopolis
|
| City |
Singapore |
| ZIP/Postal code |
470110 |
| Country |
Singapore |
| |
|
| Platform ID |
GPL21290 |
| Series (2) |
| GSE118392 |
Integrated Paired-end Enhancer Profiling and Whole-Genome Sequencing Reveals Recurrent CCNE1 and IGF2 Enhancer Hijacking in Primary Gastric Adenocarcinoma |
| GSE118491 |
Integrated Paired-end Enhancer Profiling and Whole-Genome Sequencing Reveals Recurrent CCNE1 and IGF2 Enhancer Hijacking in Primary Gastric Adenocarcinoma [4C-Seq] |
|
| Relations |
| BioSample |
SAMN09934200 |
| SRA |
SRX4623185 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM3360761_fourc-id_6-chr_19.wig.gz |
20.4 Kb |
(ftp)(http) |
WIG |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data provided as supplementary file |
|
|
|
|
 |
