|
| Status |
Public on Jul 13, 2018 |
| Title |
Control 2 [Ribo-Seq] |
| Sample type |
SRA |
| |
|
| Source name |
Mouse embryonic fibroblasts
|
| Organism |
Mus musculus |
| Characteristics |
cell type: fibroblasts
passage: passages 5-8
treatment: Si-Negative control transfection
|
| Treatment protocol |
Si-RNA [Si-Negative control or Si-eIF1A (X+18)] tranfection was performed using Lipofectamine RNAimax
|
| Growth protocol |
MEFs were grown in standard growth condition in 10 cm plates
|
| Extracted molecule |
total RNA |
| Extraction protocol |
cell lysate was treated with Rnase I followed by ultracentrifugation according to Ingolia et al. 2012
purified RNA was processed to make ribosome profiling liberaries (Ingolia et al. 2012). Ribo-seq libraries were sequenced on HiSeq2500 High-Output instrument (Illumina) to yield 60 bp single-end reads
|
| |
|
| Library strategy |
OTHER |
| Library source |
transcriptomic |
| Library selection |
other |
| Instrument model |
Illumina HiSeq 2500 |
| |
|
| Description |
Ribosome protected RNA
|
| Data processing |
Library strategy: Ribo-seq
Removing first base and adapter and keeping only sequences of length 20 to 50 (initial length 61) that had adapter, no trimming by quality. cutadapt -a CTGTAGGCACCATCAATAGATCGGAAGAGCACACGTCTGAACTCCAGTCAC --discard-untrimmed --times 1 -u 1 -m 20 -M 50
rRNA removal was done by bowtie to make fastq file with non-RNA sequences (bowtie run with parameter norc)
Filtering for reads of length 28-33 using cutadapt (-m 28 -M 33)
Mapping the reads to mm10 mouse using TopHat2 with parameters : --no-novel-juncs --library-type fr-firststrand
UTR and CDS gtf files were created from refseq gtf file, avoiding regions found in both files. HTSeq was used for the quantification (parameters -s yes -t exon -m intersection-nonempty). The option intersection-nonempty allows to assign junction reads to either the CDS or UTR, depending where most of read is placed.
Counts presented were normalized with DESeq2 (normalization was computed for the sum 5' UTR and CDS)
Genome_build: mm10
Supplementary_files_format_and_content: Ribo-Seq norm counts
|
| |
|
| Submission date |
Jul 12, 2018 |
| Last update date |
Jul 13, 2018 |
| Contact name |
Dena Leshkowitz |
| E-mail(s) |
dena.leshkowitz@weizmann.ac.il
|
| Organization name |
Weizmann Institute of Science
|
| Department |
Bioinformatics Unit, Life Sciences Core Facilities
|
| Street address |
P.O.B. 26
|
| City |
Rehovot |
| ZIP/Postal code |
76100 |
| Country |
Israel |
| |
|
| Platform ID |
GPL17021 |
| Series (2) |
| GSE116981 |
Cancer associated mutants of eIF1A impair Rps3/Rps10 binding and enhance scanning of cell cycle genes [Ribo-Seq] |
| GSE116983 |
Cancer associated mutants of eIF1A impair Rps3/Rps10 binding and enhance scanning of cell cycle genes |
|
| Relations |
| BioSample |
SAMN09645076 |
| SRA |
SRX4383841 |
