NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Sample GSM3068101 Query DataSets for GSM3068101
Status Public on Mar 27, 2018
Title EXR-DERLE1UCSF063
Sample type SRA
 
Source name Bile
Organism Homo sapiens
Characteristics condition: Liver transplant recipient
anatomical location: Entire gallbladder
rna source: total cell-free biofluid RNA
rna isolation kit: miRNeasy (Qiagen)
Extracted molecule total RNA
Extraction protocol Low speed centrifugation (5 minutes in 4 C room at 2,000 x g) was performed to pellet cells and cryoprecipitate. Extracellular vesicles were not pre-purified. RNA was isolated using miRNeasy (Qiagen).
Modified TruSeq Small RNA with randomized 4N adapters.
 
Library strategy miRNA-Seq
Library source transcriptomic
Library selection size fractionation
Instrument model Illumina HiSeq 4000
 
Data processing All FASTQ files were processed uniformly through the extra-cellular RNA processing toolkit (exceRpt), with an adapter sequence of TGGAATTCTCGGGTGCCAAGG and random barcode length 4 (on 5' and 3' ends). Information about exceRpt is available at https://rkitchen.github.io/exceRpt/.
Genome_build: hg19
Supplementary_files_format_and_content: Each processed data file is a core results archive generated by exceRpt. The core results archive contains read counts for alignments to the different transcriptome libraries used by exceRpt (miRNA / piRNA / tRNA / GENCODE annotations / circRNA), taxonomy trees for exogenous rRNA and genomic reads aligned by exceRpt, and a variety of other files generated by exceRpt.
 
Submission date Aug 07, 2018
Last update date Aug 07, 2018
Contact name David Erle
E-mail(s) david.erle@ucsf.edu
Organization name University of California, San Francisco
Street address 1550 4th Street, Bldg 19B
City San Francisco
State/province CA
ZIP/Postal code 94158
Country USA
 
Platform ID GPL20301
Series (1)
GSE112343 Large differences in small RNA composition between human biofluids - 10 biofluids
Relations
SRA SRX3848853
BioSample SAMN08796576

Supplementary file Size Download File type/resource
GSM3068101_sample_EXR-DERLE1UCSF063_fastq_DERLE1-Phase1_Open_10_Biofluids-2018-01-22_CORE_RESULTS_v4.6.2.tar.gz 3.1 Mb (ftp)(http) TAR
SRA Run SelectorHelp
Raw data are available in SRA
Processed data provided as supplementary file

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap