GEO Accession viewer

NCBI > GEO > Accession Display

Not logged in | Login

GEO help: Mouse over screen elements for information.

Sample GSM3039799

Query DataSets for GSM3039799

Status

Public on Jun 25, 2018

Title

3'-seq CLL5

Sample type

SRA

Source name

Peripheral blood mononuclear cells

Organism

Homo sapiens

Characteristics

disease status: chronic lymphocytic leukemia (CLL)
cell type: B cells CD5+ CD19+
patient id: CLL5

Extracted molecule

total RNA

Extraction protocol

Total RNA is isolated using Tri-reagent (Ambion) and DNase-treated (Ambion).
An oligo(dT) primer containing a VN-anker, a uridine, the sequence of the sequencing adapter and biotin (/5BiosG/CAGACGTGTGCTCTTCCGATCTTTTTTTTrUTTTTTTTTVN) is attached to streptavidin-coated magnetic beads (M280, Invitrogen). Total RNA is incubated for 5 min at 65°C, followed by incubation with the coated magnetic beads for 10 min at 45°C. First strand synthesis is carried out using Superscript III reverse transcriptase (Invitrogen) at 50°C. The enzyme is inactivated by incubation at 70°C for 15 min. Second strand synthesis is carried out using Second stand synthesis buffer (Invitrogen), dNTPs, DNA polymerase I (NEB), E. coli ligase (NEB) and RNase H (Invitrogen). To exchange the buffers and to remove enzymes from the previous step, we treat the samples with Pronase (Roche). We introduce a nick at the position of the uridine with RNase HII (NEB). Then, nick translation is carried out with DNA polymerase I (NEB) and dNTPs for 8 min at 8°C. The reaction is stopped by the addition of EDTA. At the new position of the nick we create a blunt end using T7 exonuclease, mung bean nuclease (NEB) and Klenow enzyme (NEB). Previously annealed Illumina TruSeq sequencing adapters (Ad1: 5'- AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT; Ad2: 5'- AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTAT) are then blunt- end ligated. The magnetic beads are suspended in 39 ul H2O. 5 ul of beads are used in a PCR reaction. 10-13 cycles of PCR are carried out with Phusion polymerase (NEB), a forward primer (5'-AATGATACGGCGACCACCGAGATC) and one of the Illumina TruSeq barcode reverse primers. For preparation of the library, 6 PCR reactions are performed, run on 8% TBE gels (Invitrogen) and the smear between 160 bp and 220 bp is cut out, gel-extracted, ethanol-precipitated, analyzed by Bioanalyzer (Agilent) and sequenced on Illumina Hi-seq machines.

Library strategy

OTHER

Library source

transcriptomic

Library selection

other

Instrument model

Illumina HiSeq 2000

Description

processed data file: ipa_tpm.txt

Data processing

Library strategy: 3'-Seq
Low-quality 3'-seq reads were trimmed by FASTQ Quality Trimmer: fastq_quality_filter Q33 -I input.fastq
Adaptors were trimmed by FASTX Clipper from FASTX-Toolkit (fastx_clipper).
Stretch of A's at the 3' end of reads were also trimmed. Reads with minimum length 21 were used for alignment.
3'-seq reads were aligned using BWA aligner: bwa aln -t 24 -l 100000 -n 0.04 -q 0
RNA-seq reads were aligned using STAR aligner.
Genome_build: hg19 (GRCh37)
Supplementary_files_format_and_content: ipa_tpm.txt: Tab-delimited text file includes tpm values.
Supplementary_files_format_and_content: counts_rnaseq.txt: Tab-delimited text file includes raw counts.

Submission date

Mar 13, 2018

Last update date

Jun 25, 2018

Contact name

Irtisha Singh

E-mail(s)

isingh@tamu.edu

Organization name

Texas A&M Health Science Center

Street address

8447 Riverside Pkwy Medical Research and Education Building II