NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Sample GSM3039799 Query DataSets for GSM3039799
Status Public on Jun 25, 2018
Title 3'-seq CLL5
Sample type SRA
 
Source name Peripheral blood mononuclear cells
Organism Homo sapiens
Characteristics disease status: chronic lymphocytic leukemia (CLL)
cell type: B cells CD5+ CD19+
patient id: CLL5
Extracted molecule total RNA
Extraction protocol Total RNA is isolated using Tri-reagent (Ambion) and DNase-treated (Ambion).
An oligo(dT) primer containing a VN-anker, a uridine, the sequence of the sequencing adapter and biotin (/5BiosG/CAGACGTGTGCTCTTCCGATCTTTTTTTTrUTTTTTTTTVN) is attached to streptavidin-coated magnetic beads (M280, Invitrogen). Total RNA is incubated for 5 min at 65°C, followed by incubation with the coated magnetic beads for 10 min at 45°C. First strand synthesis is carried out using Superscript III reverse transcriptase (Invitrogen) at 50°C. The enzyme is inactivated by incubation at 70°C for 15 min. Second strand synthesis is carried out using Second stand synthesis buffer (Invitrogen), dNTPs, DNA polymerase I (NEB), E. coli ligase (NEB) and RNase H (Invitrogen). To exchange the buffers and to remove enzymes from the previous step, we treat the samples with Pronase (Roche). We introduce a nick at the position of the uridine with RNase HII (NEB). Then, nick translation is carried out with DNA polymerase I (NEB) and dNTPs for 8 min at 8°C. The reaction is stopped by the addition of EDTA. At the new position of the nick we create a blunt end using T7 exonuclease, mung bean nuclease (NEB) and Klenow enzyme (NEB). Previously annealed Illumina TruSeq sequencing adapters (Ad1: 5'- AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT; Ad2: 5'- AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTAT) are then blunt- end ligated. The magnetic beads are suspended in 39 ul H2O. 5 ul of beads are used in a PCR reaction. 10-13 cycles of PCR are carried out with Phusion polymerase (NEB), a forward primer (5'-AATGATACGGCGACCACCGAGATC) and one of the Illumina TruSeq barcode reverse primers. For preparation of the library, 6 PCR reactions are performed, run on 8% TBE gels (Invitrogen) and the smear between 160 bp and 220 bp is cut out, gel-extracted, ethanol-precipitated, analyzed by Bioanalyzer (Agilent) and sequenced on Illumina Hi-seq machines.
 
Library strategy OTHER
Library source transcriptomic
Library selection other
Instrument model Illumina HiSeq 2000
 
Description processed data file: ipa_tpm.txt
Data processing Library strategy: 3'-Seq
Low-quality 3'-seq reads were trimmed by FASTQ Quality Trimmer: fastq_quality_filter Q33 -I input.fastq
Adaptors were trimmed by FASTX Clipper from FASTX-Toolkit (fastx_clipper).
Stretch of A's at the 3' end of reads were also trimmed. Reads with minimum length 21 were used for alignment.
3'-seq reads were aligned using BWA aligner: bwa aln -t 24 -l 100000 -n 0.04 -q 0
RNA-seq reads were aligned using STAR aligner.
Genome_build: hg19 (GRCh37)
Supplementary_files_format_and_content: ipa_tpm.txt: Tab-delimited text file includes tpm values.
Supplementary_files_format_and_content: counts_rnaseq.txt: Tab-delimited text file includes raw counts.
 
Submission date Mar 13, 2018
Last update date Jun 25, 2018
Contact name Irtisha Singh
E-mail(s) isingh@tamu.edu
Organization name Texas A&M Health Science Center
Street address 8447 Riverside Pkwy Medical Research and Education Building II
City Bryan
State/province TX
ZIP/Postal code 77807
Country USA
 
Platform ID GPL11154
Series (1)
GSE111793 Widespread intronic polyadenylation inactivates tumor suppressor genes in leukemia
Relations
BioSample SAMN08706763
SRA SRX3786336

Supplementary data files not provided
SRA Run SelectorHelp
Raw data are available in SRA
Processed data are available on Series record

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap