|
| Status |
Public on Sep 30, 2019 |
| Title |
HITS-CLIP_Cortex3 |
| Sample type |
SRA |
| |
|
| Source name |
cortex
|
| Organism |
Mus musculus |
| Characteristics |
tissue: brain
degenerate linker: 25nt: begins with GCAT or CATG, ends with G
|
| Growth protocol |
Cells were grown under standard conditions.
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Brain tissue and cell lines were UV irradiated and subjected to Elavl HITS-CLIP (detailed description in accompanying paper)
partial RNAse digestion, RNA linker ligation and PCR amplificiation
Elavl bound fragments were ligated to a degenerate 5'linker and a 3'linker
|
| |
|
| Library strategy |
OTHER |
| Library source |
transcriptomic |
| Library selection |
other |
| Instrument model |
Illumina MiSeq |
| |
|
| Description |
Elavl-CLIP
Elavl.2month.CLIP_peaks.txt.gz
|
| Data processing |
Library strategy: HITS-CLIP
filtering (min:0-4:20,mean:5-29:20)
collapsing of exact sequences
stripping of 5'degenerate linker (7 or 25nt)
removal of 3'adaptor (GTGTCAGTCACTTCCAGCGG)
alignment with novoalign (unambigous mapping)
collapsing of PCR duplicates
Genome_build: hg19
Supplementary_files_format_and_content: bed file containing genomic coordinates of 50bp region of CLIP peaks
|
| |
|
| Submission date |
Sep 19, 2017 |
| Last update date |
Sep 30, 2019 |
| Contact name |
Robert Darnell |
| Organization name |
Rockefeller University
|
| Street address |
1230 York Ave
|
| City |
New York |
| State/province |
New York |
| ZIP/Postal code |
10065 |
| Country |
USA |
| |
|
| Platform ID |
GPL16417 |
| Series (1) |
|
| Relations |
| BioSample |
SAMN07672115 |
| SRA |
SRX3198632 |
