 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Oct 17, 2017 |
| Title |
day0_ES |
| Sample type |
SRA |
| |
|
| Source name |
Embryonic stem cell (ESC)
|
| Organism |
Mus musculus |
| Characteristics |
cell type: Embryonic stem cell (ESC)
timepoint/stage: Day 0 (undifferentiated)
# cells (pass filter): 969
strain: N/A
differentiation protocol: starting population
|
| Treatment protocol |
I. CELL CULTURE: Twenty-four hours before starting differentiation, ESCs were trypsinized and seeded onto plates pre-coated with a mix of poly-d-lysine (100 ug/ml) and laminin (50 ug/ml) instead of gelatin for adherence. ESCs were counted by a Beckman Coulter Counter and seeded at a density of approximately 200,000 cells per well of a 6-well dish. At day 0 (ESCs), the media was switched from standard ES media to N2B27 media (Invitrogen). Doxycycline was also added at 3 ug/ml starting to induce expression of the NIL transcription factors. Media was changed daily. For the standard programming protocol, the steps described in Wu et al. were followed strictly. II. MOUSE WORK: The B6.Cg-Tg(Hlxb9-GFP)1Tmj/J mice (JAX# 005029) were bred with C57BL/6J (JAX# 000664) for embryonic motor neurons dissection. All animal protocols were approved the Institutional Animal Care and Use Committee at Boston Children’s Hospital. On gestational day 13 (E13), the female mice were anesthetized and all embryos were collected by caesarian section. Only GFP embryos were used for further dissection. The spinal cords were isolated and their meninges were removed. Each isolated spinal cord was dissociated by trypsin and mechanical trituration. After filtering the cells with 100 μm strainers, the cells were spun down and re-suspended in PBS, and subjected to flow cytometry. Cells were run through a 100 μm nozzle at low pressure (20 p.s.i.) on a BD FACSaria II machine (Becton Dickinson, USA). A neural density filter (2.0 setting) was used to allow visualization of large cells.
|
| Growth protocol |
ESCs were cultured in standard media (DMEM with LIF + 15% fetal bovine serum) on 0.2% gelatin-coated dishes.
|
| Extracted molecule |
polyA RNA |
| Extraction protocol |
Cells were encapsulated using the inDrops platform, into droplets on ice and lysed in the 4nL microfluidic droplets using a final concentration of 0.4% NP-40. Single cell lysates were subject to reverse transcription at 50°C without purification of RNA (as previously described in Klein et al., Cell 2015).
Libraries were prepared as in Zilionis et al., Nature Protocols (2017), with the exception of the first round of libraries, for which the final PCR step was carried out as in Klein et al., Cell 2015.
|
| |
|
| Library strategy |
RNA-Seq |
| Library source |
transcriptomic |
| Library selection |
cDNA |
| Instrument model |
Illumina NextSeq 500 |
| |
|
| Description |
Sample 1
Timepoint label = 1 in processed data files (both protocols)
direct_programming.filtered_normalized_counts.csv.gz
direct_programming.raw_umifm_counts.csv.gz
standard_protocol.filtered_normalized_counts.csv.gz
standard_protocol.raw_umifm_counts.csv.gz
|
| Data processing |
The barcode read was first filtered based on presence of two sample barcode components separated by the W1 adaptor sequence (GAGTGATTGCTTGTGACGCCTT), as previously described (Klein et al., Cell 2015).
The cDNA read was then trimmed using Trimomatic (5) (version 0.32; parameters: LEADING:28 SLIDINGWINDOW:4:20 MINLEN:30).
Barcodes for each read were matched against a list of the pre-determined barcodes, and errors of up to two nucleotides mismatch were corrected. Reads with a barcode separated by more than two nucleotides from the reference list were discarded. The reads were then split into barcode-specific files for mapping and UMI filtering.
The trimmed reads were aligned using Bowtie (version 1.1.1, parameters: -n 1 -l 15 -e 100 -m 200 -best -strata -a) to the mouse transcriptome. The reference transcriptome was built using annotations from ENSEMBL (GRCm38.81) including all annotations with ""Transcript Support Levels"" of 1, 2, or NA (only accepted for protein coding genes).
A custom Python and PySAM script to process mapped reads into counts of UMI-filtered transcripts per gene, as previously described (Zilionis et al., Nature Protocols in press)
Genome_build: GRCm38
Supplementary_files_format_and_content: The raw_umifm_counts files include raw unique molecular identifier (UMI)-filtered counts for all transcriptomes (prior to filtering). The filtered_normalized_counts files have normalized counts for transcriptomes passing all filtering steps. In both cases, columns = cells (with the exception of the first column), rows = genes (with the exception of the first two rows). Column 1 gives the label for each row. Row 1 contains the timepoint label (1 = day 0; 2 = day 5/6; 3 = day 11/12). In raw_umifm_counts files, row 2 contains flag for cell pass filtering (0=fail, 1=pass). In filtered_normalized_counts files, row 2 contains an integer cluster label. Cluster labels follow Briggs, JA and Li, VC et al. For direct_programming, clusterIDs -1:11 = outlier, ESC, NP, EMN, LMN, FN, NN, Gl1, Gl2, Mus, Meso, Endo, respectively. For the standard_protocol, clusterIDs -1:11 = outlier, ESC, NP, PNP, PVNP, MNP, EMN, LMN, Oligo, Astro, Mus, Stro. Rows 3+ contain counts for each gene (gene symbol is in column 1). The SPRING_combined_trajectories file contains a subset of cells from each protocol merged together under the same format except row 1 = Cluster ID, and rows 2+ contain counts for each gene. Data has been total count normalized. The included cells are described in the manuscript and represent the major motor neuron differentiation pathway of both protocols. Cluster 1 = ES; clusters 2-4 = direct_programming (NP, EMN, LMN); clusters 5-10 = standard_protocol (NP, PNP, PVNP, MNP, EMN, LMN).
|
| |
|
| Submission date |
Apr 04, 2017 |
| Last update date |
May 15, 2019 |
| Contact name |
James Alexander Briggs |
| E-mail(s) |
james.briggs@uqconnect.edu.au
|
| Organization name |
Harvard Medical School
|
| Department |
Department of Systems Biology
|
| Lab |
Kirschner / Klein labs
|
| Street address |
200 Longwood Avenue, Harvard Medical School
|
| City |
Boston |
| State/province |
Massachusetts |
| ZIP/Postal code |
02115 |
| Country |
USA |
| |
|
| Platform ID |
GPL19057 |
| Series (2) |
| GSE97390 |
Mouse embryonic stem cells can differentiate via multiple paths to the same state [RNA-seq] |
| GSE97391 |
Mouse embryonic stem cells can differentiate via multiple paths to the same state |
|
| Relations |
| BioSample |
SAMN06684240 |
| SRA |
SRX2705257 |
| Supplementary data files not provided |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data are available on Series record |
|
|
|
|
 |
