GEO Accession viewer

NCBI > GEO > Accession Display

Not logged in | Login

GEO help: Mouse over screen elements for information.

Sample GSM2341637

Query DataSets for GSM2341637

Status

Public on Nov 15, 2016

Title

H3K4me3-ChIPseq

Sample type

SRA

Source name

U2OS

Organism

Homo sapiens

Characteristics

cell line: U2OS
RNAi: none
damid tagged factor: none
antibody source: H3K4me3 (Abcam: ab8580, GR273043-2)

Treatment protocol

RNAi mediated gene silencing was performed using the following oligos (Invitrogen): control (Luc; 5’ UAUGCAGUUGCUCUCCAGC), Nup153 (5’-ACAUUUGGUAGAGUCUGCCUU) and Nup93 (5’-GCGCUAAUUUACUACUGCA) and delivered using siLenFect (Bio-Rad). For DamID-Seq experiments, the heat shock promoter, ecodam tag and RFC.1 region of the pLgw EcoDam-V5-RFC1 vector (a kind gift of Dr. Bas Van Steensel) was cloned into the polylinker of the pMSCV-puro vector yielding pMSCV-ED-puro. Subsequently, cDNAs (GFP, Nup153, LBR, mNup93) were inserted using the Gateway cloning system (Thermofisher) and the final product was used to transduce the cells. 48 hours after transduction, puromycin (1μg/ml) was added to select transduced cells.

Growth protocol

U2OS cells were cultured in DMEM (Gibco), 10% FBS. IMR90 cells in DMEM 20% FBS supplemented with nonessential aminoacids (Gibco) and low oxygen conditions (3%).

Extracted molecule

genomic DNA

Extraction protocol

ChIP-seq: cells were cross-linked with 1% formaldehyde at room temperature for 10 min and neutralized with 0.125 M glycine. After sonication,chromatin was incubated with 5–10 μg of antibody at 4°C overnight. Immunoprecipitated complexes were collected using Dynabeads M280 sheep-anti-rabbit IgG or sheep-anti-mouse IgG (Invitrogen). Subsequently, immuno-complexes were washed, decorsslinked and DNA was purified by QIAquick Spin columns (Qiagen).
ChIP-Seq and DamID-Seq libraries were generated using the TruSeq ChIP sample Prep kit (Illumina) or the Kapa Hyper Prep Kit for Illumina Platforms followed by Illumina sequencing.

Library strategy

ChIP-Seq

Library source

genomic

Library selection

ChIP

Instrument model

Illumina HiSeq 2500

Description

ChIP-Seq of trimethylated H3K4me3
processed data file: H3K4me3.peaks.bed.gz

Data processing

Basecalls performed using CASAVA version 1.8.2
Reads were aligned to the human genome (hg19) using bowtie2 (v2.1.0) for DamID, ChIP-seq, and DNase-Seq. In the case of DNase-seq reads, 3' adapter sequences needed to be removed (starting with AGTCGTGATGTTCGTATGCCGTCTTC). STAR (v2.2.0c) was used for RNA-Seq. In all cases, only reads that mapped to a unique genomic locations (MAPQ > 10) were used for downstream analysis. DamID reads were further removed if the read was not preceeded by a GATC in the genome (read starting immediately after the GATC).
HOMER (v4.6) was used to process alignment files to generate normalized bedGraphs and bigwigs for the UCSC Genome Browser. DamID peaks for Nup153 and Nup93 were found by merging replicates and using the findPeaks program in HOMER with the following options "-style histone -o auto -size 2500 -minDist 2500 -tbp 0 -inputtbp 0 -fragLength 1 -inputFragLength 1 -F 2 -C 0 -ntagThreshold 100" using the GFP DamID experiments as background. LBR-defined LADs are much more broad than other features and were defined by first creating a log2 normalized bedGraph of LBR-DamID vs. GFP-DamID smoothed over a range of 100 kb, then taking defining enriched regions with a log2 ratio greater 0.30. Regions within 200 kb were merged to larger domains, and finally only regions greater than 200kb in size were considered as TADs to avoid noise. ChIP-Seq peaks were founding using the findPeaks program in HOMER using the paramter "-style histone" to find broad peaks for H3K4me3 and H3K9me2 peaks or "-style super" to find super enhancers from H3K27ac peaks using input as background. CTCF peaks were found using the parameter "-style factor". DNase-Seq peaks were found using HOMER findPeaks using the option "-style dnase". For RNA-Seq, Reads Per Kilobase of exon per milion mapped reads were calculated using HOMER (http://homer.salk.edu/homer/) across annotated gene exons (RefSeq).
Genome_build: hg19
Supplementary_files_format_and_content: BED file Columns: (1) chr (2) start (3) end (4) peakName (5) peak score (6) strand. FPKM Tab delimited text file, Columns: (1) RefSeq acc (2) chr (3) start (4) end (5) strand (6) length (7) copies (8) annotation (9-) FPKM for each experiment

Submission date

Oct 11, 2016

Last update date

May 15, 2019

Contact name

Christopher Benner

E-mail(s)

cbenner@ucsd.edu

Organization name

University of California, San Diego (UCSD)

Department

Medicine