|
| Status |
Public on Mar 21, 2017 |
| Title |
IB_sRNA_rat_PT12 |
| Sample type |
SRA |
| |
|
| Source name |
parathyroid
|
| Organism |
Rattus norvegicus |
| Characteristics |
tissue: parathyroid
patient/animal id: 1wPT12
parathyroid pathology: hyperplastic-1wAHP
barcode: 26.80
|
| Extracted molecule |
total RNA |
| Extraction protocol |
TRIzol-based (see PMID: 24489795)
ligation/gel-based small RNA cDNA library (see PMID: 24489795)
|
| |
|
| Library strategy |
miRNA-Seq |
| Library source |
transcriptomic |
| Library selection |
size fractionation |
| Instrument model |
Illumina Genome Analyzer IIx |
| |
|
| Description |
3' adapter sequence: TCGATTCGTATGCCGTCTTCTGCTTG
|
| Data processing |
Illumina GA Iix/HiSeq 2000 standard base-calling
RNAworld in-house allingment and annotation pipeline (see PMID: 22836126)
Genome_build: hg19/mmu9/rn4
Supplementary_files_format_and_content: count tables in xlsx format separate for each species; 3 tabs in each file: mature/star miRNA counts, sequence family counts, precursor cluster counts
|
| |
|
| Submission date |
Mar 30, 2016 |
| Last update date |
May 15, 2019 |
| Contact name |
Iddo Z. Ben-Dov |
| E-mail(s) |
iddo@hadassah.org.il
|
| Phone |
+97226776881
|
| Organization name |
Hadassah Medical Center
|
| Department |
Nephrology and Hypertension
|
| Lab |
Laboratory of Medical Transcriptomics
|
| Street address |
Ein Kerem
|
| City |
Jerusalem |
| ZIP/Postal code |
91120 |
| Country |
Israel |
| |
|
| Platform ID |
GPL10669 |
| Series (1) |
| GSE79727 |
microRNA profiling in normal and hyperplastic human and murine parathyroid glands |
|
| Relations |
| BioSample |
SAMN04590726 |
| SRA |
SRX1670313 |
