 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Jan 20, 2019 |
| Title |
IY_1b |
| Sample type |
SRA |
| |
|
| Source name |
no hepatectomy, serum
|
| Organism |
Mus musculus |
| Characteristics |
strain: CD-1
gender: male
protocol: no treatment
rna source: serum
|
| Extracted molecule |
total RNA |
| Extraction protocol |
ExoQuick followed by SeraMir Kit (System Biosciences)
NEBNext Small RNA Library
|
| |
|
| Library strategy |
miRNA-Seq |
| Library source |
transcriptomic |
| Library selection |
size fractionation |
| Instrument model |
Illumina MiSeq |
| |
|
| Data processing |
Genboree Bioinformatics exceRpt pipeline v2.2.2, using the default parameters. The general steps were listed below.
Trim the adaptor sequence AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC and filter out reads that are short after adaptor trimming.
Filter out reads that are mapped (using bowtie2) to UniVec contaminants, 45S, 5S and rRNAs
Map the remaining reads to mm10 genome, miRNA sequence (miRBase v21), piRNA sequences (RNAdb) and tRNA sequences (gtRNAdb), using bowtie. The allowed mismatch is 1 for miRNA and 2 for others.
Count miRNA reads, piRNA reads and tRNA reads.
Normalize raw read counts by log2 (Count Per Million)
Genome_build: mm10
Supplementary_files_format_and_content: Text file separated by tab with column names that have miRNA raw read count information. "UR" column means "number of unique reads", "RC" column means "total number of reads (not necessarily uniquely mapped".
|
| |
|
| Submission date |
Jan 20, 2016 |
| Last update date |
May 15, 2019 |
| Contact name |
Tushar Patel |
| Organization name |
Mayo Clinic
|
| Street address |
4500 San Pablo S
|
| City |
Jacksonville |
| State/province |
FL |
| ZIP/Postal code |
32246 |
| Country |
USA |
| |
|
| Platform ID |
GPL16417 |
| Series (1) |
| GSE77045 |
Circulating extracellular RNA markers of liver regeneration |
|
| Relations |
| BioSample |
SAMN04457010 |
| SRA |
SRX1561317 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM2043043_IY_1_reSeq_miRBase.txt.gz |
7.3 Kb |
(ftp)(http) |
TXT |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data provided as supplementary file |
|
|
|
|
 |
