|
Status |
Public on Apr 01, 2015 |
Title |
1:100 dilution, day 4, repeat 2 (8B) |
Sample type |
SRA |
|
|
Source name |
S2R+ cell line
|
Organism |
Drosophila melanogaster |
Characteristics |
cell line: S2R library dilution: 100x dilution timepoint: Day 4 biological repeat: 2
|
Treatment protocol |
None
|
Growth protocol |
28C, Schneider's medium (Sigma) + 10% FBS (Invitrogen)
|
Extracted molecule |
genomic DNA |
Extraction protocol |
gDNA was extracted with a Zymo Quick gDNA extraction kit. sgRNA sequences were amplified using primers ScreenF2 (TAGGTATGTTTTCCTCAATACTTCG) and ScreenR (CGGACTAGCCTTATTTTAACTTGC) Adaptors were added with a second round of PCR including 5' and 3' barcodes, as described in metadata.txt. 9 different 5' variable length barcode, and 2 different 6 nt barcodes at the 3' end
|
|
|
Library strategy |
OTHER |
Library source |
genomic |
Library selection |
other |
Instrument model |
Illumina MiSeq |
|
|
Description |
PCR product from gDNA
|
Data processing |
Custom Perl script to extract different barcoded libraries and trim to unique 19 nt sgRNA sequence Custom Perl script to count sgRNA sequences from each library Genome_build: dm3 Supplementary_files_format_and_content: sgRNA_counts.out - Tab delimited text file describing counts for every sgRNA in the library for each of the 18 samples Supplementary_files_format_and_content: metadata.txt - Information about barcoding strategy and sample details
|
|
|
Submission date |
Mar 26, 2015 |
Last update date |
May 15, 2019 |
Contact name |
Ji-Long Liu |
E-mail(s) |
jilong.liu@dpag.ox.ac.uk
|
Phone |
+44 (0)1865 285833
|
Organization name |
University of Oxford
|
Department |
MRC Functional Genomics Unit, Department of Physiology, Anatomy and Genetics
|
Street address |
South Parks Road
|
City |
Oxford |
ZIP/Postal code |
OX1 3PT |
Country |
United Kingdom |
|
|
Platform ID |
GPL16479 |
Series (1) |
GSE67339 |
A genome-wide CRISPR library for high-throughput genetic screening in Drosophila cells |
|
Relations |
BioSample |
SAMN03449123 |
SRA |
SRX970791 |