|
| Status |
Public on Apr 01, 2015 |
| Title |
1:10 dilution, day 4, repeat 2 (5B) |
| Sample type |
SRA |
| |
|
| Source name |
S2R+ cell line
|
| Organism |
Drosophila melanogaster |
| Characteristics |
cell line: S2R
library dilution: 10x dilution
timepoint: Day 4
biological repeat: 2
|
| Treatment protocol |
None
|
| Growth protocol |
28C, Schneider's medium (Sigma) + 10% FBS (Invitrogen)
|
| Extracted molecule |
genomic DNA |
| Extraction protocol |
gDNA was extracted with a Zymo Quick gDNA extraction kit. sgRNA sequences were amplified using primers ScreenF2 (TAGGTATGTTTTCCTCAATACTTCG) and ScreenR (CGGACTAGCCTTATTTTAACTTGC)
Adaptors were added with a second round of PCR including 5' and 3' barcodes, as described in metadata.txt. 9 different 5' variable length barcode, and 2 different 6 nt barcodes at the 3' end
|
| |
|
| Library strategy |
OTHER |
| Library source |
genomic |
| Library selection |
other |
| Instrument model |
Illumina MiSeq |
| |
|
| Description |
PCR product from gDNA
|
| Data processing |
Custom Perl script to extract different barcoded libraries and trim to unique 19 nt sgRNA sequence
Custom Perl script to count sgRNA sequences from each library
Genome_build: dm3
Supplementary_files_format_and_content: sgRNA_counts.out - Tab delimited text file describing counts for every sgRNA in the library for each of the 18 samples
Supplementary_files_format_and_content: metadata.txt - Information about barcoding strategy and sample details
|
| |
|
| Submission date |
Mar 26, 2015 |
| Last update date |
May 15, 2019 |
| Contact name |
Ji-Long Liu |
| E-mail(s) |
jilong.liu@dpag.ox.ac.uk
|
| Phone |
+44 (0)1865 285833
|
| Organization name |
University of Oxford
|
| Department |
MRC Functional Genomics Unit, Department of Physiology, Anatomy and Genetics
|
| Street address |
South Parks Road
|
| City |
Oxford |
| ZIP/Postal code |
OX1 3PT |
| Country |
United Kingdom |
| |
|
| Platform ID |
GPL16479 |
| Series (1) |
| GSE67339 |
A genome-wide CRISPR library for high-throughput genetic screening in Drosophila cells |
|
| Relations |
| BioSample |
SAMN03449118 |
| SRA |
SRX970785 |
