NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Sample GSM1645026 Query DataSets for GSM1645026
Status Public on Apr 01, 2015
Title 1:0 dilution, day 1, repeat 1 (1A)
Sample type SRA
 
Source name S2R+ cell line
Organism Drosophila melanogaster
Characteristics cell line: S2R
library dilution: No dilution
timepoint: Day 1
biological repeat: 1
Treatment protocol None
Growth protocol 28C, Schneider's medium (Sigma) + 10% FBS (Invitrogen)
Extracted molecule genomic DNA
Extraction protocol gDNA was extracted with a Zymo Quick gDNA extraction kit. sgRNA sequences were amplified using primers ScreenF2 (TAGGTATGTTTTCCTCAATACTTCG) and ScreenR (CGGACTAGCCTTATTTTAACTTGC)
Adaptors were added with a second round of PCR including 5' and 3' barcodes, as described in metadata.txt. 9 different 5' variable length barcode, and 2 different 6 nt barcodes at the 3' end
 
Library strategy OTHER
Library source genomic
Library selection other
Instrument model Illumina MiSeq
 
Description PCR product from gDNA
Data processing Custom Perl script to extract different barcoded libraries and trim to unique 19 nt sgRNA sequence
Custom Perl script to count sgRNA sequences from each library
Genome_build: dm3
Supplementary_files_format_and_content: sgRNA_counts.out - Tab delimited text file describing counts for every sgRNA in the library for each of the 18 samples
Supplementary_files_format_and_content: metadata.txt - Information about barcoding strategy and sample details
 
Submission date Mar 26, 2015
Last update date May 15, 2019
Contact name Ji-Long Liu
E-mail(s) jilong.liu@dpag.ox.ac.uk
Phone +44 (0)1865 285833
Organization name University of Oxford
Department MRC Functional Genomics Unit, Department of Physiology, Anatomy and Genetics
Street address South Parks Road
City Oxford
ZIP/Postal code OX1 3PT
Country United Kingdom
 
Platform ID GPL16479
Series (1)
GSE67339 A genome-wide CRISPR library for high-throughput genetic screening in Drosophila cells
Relations
BioSample SAMN03449117
SRA SRX970776

Supplementary data files not provided
SRA Run SelectorHelp
Raw data are available in SRA
Processed data are available on Series record

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap